1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marishachu [46]
3 years ago
10

Enzymes act as catalysts because

Biology
2 answers:
professor190 [17]3 years ago
8 0
<span>b.) they lower the activation energy
hope i helped

</span>
Elza [17]3 years ago
7 0
B. this was one of my questions on a quiz for k12 :)
You might be interested in
Answer the following for me, please
andrey2020 [161]
I'm not sure about number 1 or number 6, but I know that 3 is nucleic acid and 5 is solution.
4 0
3 years ago
What does nucles do as a function in a cell?
Jet001 [13]
Nucleus has genetic material (DNA) inside it, so it commands the cell about how it has to be function......
4 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Fill in the blank with the correct abbreviation or symbol for the definition provided<br> Every day
PSYCHO15rus [73]

The correct abbreviation for the term Every Day is Daily.

<h3>What is an abbreviation?</h3>

An abbreviation is a term to refer to an orthographic convention that shortens the writing of a certain term or expression, and consists of the written representation of a word or group of words with only one or more of its letters.

According to the above, Daily is a correct abbreviation for the term Every Day since it expresses the same meaning with fewer letters. Additionally, this abbreviation is used in the medical field to tell patients when to take their medicine.

Doctors usually put Daily when their patient must take a medicine once a day.

Learn more about abbreviation in: brainly.com/question/17353851

#SPJ1

5 0
2 years ago
Which describes your body's general response to all kinds of injury, from cuts and scrapes to internal damage?
mezya [45]
I think it is inflamation, but not entirly shure
3 0
3 years ago
Read 2 more answers
Other questions:
  • The diagram represents a food web in a marine ecosystem which statement best describes the role of two populations within this f
    15·2 answers
  • The ability of the body to perform prolonged, large-muscle, dynamic exercise at moderate to high levels of intensity is called:
    13·1 answer
  • The biome with the most diverse communities of organisms is the
    12·2 answers
  • Which division of the plant kingdom is made up of plants that have flowers or fruit?
    7·2 answers
  • Practice the above directional terms by describing the following relationships: The trachea (windpipe) is ___________ to the eso
    7·1 answer
  • What are the two main principles of Mendelian genetics?
    10·2 answers
  • Which is a TRUE statement about the energy pyramid shown?
    7·1 answer
  • Girls often have better developed fine motor skills until ____. (fill in the blank)
    12·1 answer
  • How do photosynthesis and cellular respirations form a continuous cycle?
    11·1 answer
  • Which of the following distinguishes the part of the plant at the center of the flower?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!