1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
STatiana [176]
4 years ago
8

What does funds mean in biology?

Biology
1 answer:
allochka39001 [22]4 years ago
3 0
According to Google, in biology (or science), it means "to cover any funding for scientific research"
You might be interested in
Why is meiosis necessary??
IRINA_888 [86]
Meiosis is the production of sexual gametes like sperm and egg. It is only necessary for sexual reproduction but not growth.
3 0
3 years ago
In a dihybrid cross, the F2 will have nine genotypes, but only four phenotypes because the 1).________genes cause the 2)._______
Rashid [163]
1. Hetero
2. Dom
3. recess
5 0
3 years ago
When do the respiratory and circulatory systems work together?
GaryK [48]
D to supply nutrients
4 0
3 years ago
Which of the following is NOT a pyrimidine?
Nostrana [21]
That'll be guanine. If you look up "pyrimidine" in google, it will tell you the two nucleotides that are pyrmidines are cytosine and thymine. So that leaves guanine. 
6 0
3 years ago
Animals can be classified according to their mode of thermoregulation. Sort the animals below, indicating their likely thermoreg
Gemiola [76]

Answer:

Explanation:  Eagles   are endotherm and homoeothermic.

Coyote are endotherms and homoeothermic.

Walrus are Endothermic and homoeothermic.

The above organisms maintain constant internal body temperature irrespective of fluctuations  in surrounding temperature.

Artic shrimp are ectotherms; and homoeothermic. Despite the fact that it has  negligible source of intenal heat, its environmental temperature is relatively stable, therefore it  is both ectotherms and homoeothermic.

Butterfly, freshwater catfish, Salamander are Poikilothermic.  These organism’s body temperature fluctuates with  the immediate  surrounding temperature. They lack internal body temperature.

3 0
3 years ago
Other questions:
  • A transparent specimen is viewed through a microscope using _____ light while an opaque object requires _____ illumination.
    13·2 answers
  • A pre-purchase inspection differs from a pre-sale inspection in that
    5·1 answer
  • Explain how Avery discovered the transforming factor.
    8·1 answer
  • The analytical approach to understanding the diversity and relatedness of both extant and extinct organisms is called __________
    14·1 answer
  • If you wanted to start a new business that rents sun-shielding umbrellas to tourists, which of these risks would be MOST IMPORTA
    7·2 answers
  • Five-year-old jared begins to suck his thumb when his parents bring his newborn sister home from the hospital. jared is relying
    9·1 answer
  • What effect does the gradual decrease in ph from 13 to 1 have on the action of amylase
    9·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which of the following choices correctly
    10·1 answer
  • For each following, identify whether it is considered part of the atmosphere, hydrosphere, biosphere, or lithosphere/geosphere i
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!