1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WARRIOR [948]
3 years ago
13

After buying a new house by the lake, the Harrison's decided to cut down the trees and bushes that were blocking

Biology
1 answer:
madam [21]3 years ago
5 0
Sediment . The trees was blocking the view so its organic
You might be interested in
A client in a long-term care facility has signed a form stating that he does not want to be resuscitated. he develops an upper r
Dennis_Churaev [7]
The nurse should issue a code blue
8 0
3 years ago
Read 2 more answers
Need help fast!!!!!!
vova2212 [387]
Their health , medical conditions, diseases
8 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Which one would this be?
klasskru [66]

Answer:

B

Explanation:

Proteins are made up of smaller building blocks called amino acid.

8 0
3 years ago
Which of these choices is the primary purpose of the Ramsar Convention
MatroZZZ [7]

Answer:

As the choices are not given, so let's have a look at the Ramsar Convention in general.

Explanation:

In 1971, different countries around the globe signed a treaty in Ramsar, Iran for the conservation and sustainable usage of different wetlands around the world. The conservation of wetlands is important because the wetlands have a diversified flora and fauna. Destruction of the wetlands would result in many animals and plant species around the world to become extinct or endangered. Hence, this treaty was signed by different countries of the world as an understanding of the current situation of the wet lands.

3 0
3 years ago
Read 2 more answers
Other questions:
  • The type of deformation in which the object permanently changes size and shape without fracturing is called
    8·1 answer
  • Type of material transport that requires energy from the cell
    11·1 answer
  • Match the following terms and definitions.
    9·2 answers
  • Quiz 4 : Taxonomy and origins
    15·1 answer
  • What happens to the kinetic energy of a snowball as it rolls across the lawn and gains mass.
    8·2 answers
  • What three continents does the tropic of cancer pass through?
    8·1 answer
  • Bees with a larger wingspan were able to produce more offspring, making the trait more common. It could be said that ____ favore
    13·1 answer
  • The hardy-weinberg equation can be applied to estimate allele frequencies in future generations based on the current _________ f
    5·1 answer
  • B. Mutations:<br> 1. Ways to get mutations mistakes from DNA replication, but also from:
    9·1 answer
  • Is pawpaw a local food crop
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!