1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IgorLugansk [536]
3 years ago
11

One of the consequences of poverty is that poverty stricken people _____.

Biology
2 answers:
likoan [24]3 years ago
7 0

Answer:

The answer to you question is a

34kurt3 years ago
4 0

The correct answer is (a) Poverty stricken people are less able to enjoy society's benefits.

The benefits of society includes many facilities such as financial benefits, or assistance for education, assistance for unemployment and many more. The poor people lack these kinds of facilities because they do not belong to a proper commodity that are served by these kinds of facilities. These kinds of facilities are only enjoyed by the elite class of the society.


You might be interested in
How would you describe an allele that be expressed and determines an organisms appearance?
IceJOKER [234]
I think it would be D. Dominant
7 0
3 years ago
3. In addition to surface tension, what's responsible for driving ocean waves?
ololo11 [35]

Answer:

The Coriolis effect- C.

6 0
3 years ago
Read 2 more answers
Where in a cell can DNA be found?
babunello [35]

Answer:

in the nucleus

Explanation:

6 0
3 years ago
Read 2 more answers
Eukaryotic flagella differ from prokaryotic flagella because only eukaryotic flagella
Neporo4naja [7]
E. Contain microtubules 
4 0
3 years ago
The energy plants gain through photosynthesis is stored in–
zepelin [54]

Answer:

chloroplasts

Explanation:

7 0
3 years ago
Other questions:
  • Theories are ideas that scientist are most certain about true or false
    9·2 answers
  • Resources that can be replenished over a relatively short time span are called _____.
    9·2 answers
  • What is meant by scientific methods
    15·1 answer
  • Mushrooms may look like plants, but they’re actually fungi. What are the similarities and differences between fungi and plants
    8·2 answers
  • What does an organ's structure is important for its function mean
    10·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • What are the two parts of the Theory of Evolution
    11·1 answer
  • Newborn infants were given either smooth or knobby pacifiers to suck. They were later allowed to look at both types of pacifiers
    13·1 answer
  • The division of the organelles of eukaryotic cells into separate sections according to their processes is known as?
    8·1 answer
  • Is human reproduction controlled by the nervous system? True or false.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!