1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Luba_88 [7]
3 years ago
9

- comparing species definitions three of the most prominent definitions of species are the biological species concept, the phylo

genetic species concept, and the morphological species (morphospecies) concept. drag each characteristic to the appropriate bin based on the species concept(s) to which it applies.
Biology
1 answer:
wariber [46]3 years ago
7 0
It is different types of species about .biological species concept, the phylogenetic species concept, and the morphological species (morphospecies) concept
You might be interested in
In blue-white screening, what do blue colonies represent?
Basile [38]

Answer:

The correct option is : cells containing empty plasmid vectors

Explanation:

The blue-white screen is a technique which involves the rapid identification of the recombinant bacteria in a vector-based molecular cloning experiment. In this method, a DNA ligated vector is inserted in a host cell which is viable for transformation and grown in presence of X-gal.    

The cells that are transformed with the vectors having the recombinant DNA produce the white colonies. Whereas, the cells transformed with empty vector i.e. the non-recombinant plasmids, produce the blue colonies.

3 0
3 years ago
Cystic fibrosis is a genetic disease in humans in which the CFTR protein, which functions as a chloride ion channel, is missing
KiRa [710]

Answer:

ABC transporter protein

Explanation:

ABC transporter protein refers to the ATP binding cassette protein which utilizes the AT energy to transport the substrates from one side to another side. The ABC proteins are one of the oldest proteins known in the organisms.

The CFTR protein which acts as a chloride channel in the membrane which transports the chloride ions across the membrane utilizes the ATP energy in the transport.

Thus, ABC transporter protein is correct

4 0
3 years ago
️What's Photosynthesis ?️​
Snowcat [4.5K]

☁️ Answer ☁️

Photosynthesis is a process by which phototrophs convert light energy into chemical energy, which is later used to fuel cellular activities. The chemical energy is stored in the form of sugars, which are created from water and carbon dioxide.

Hope it helps.

Have a nice day noona!~  ̄▽ ̄

5 0
3 years ago
Read 2 more answers
Why patients with moscular dystrophy suffer from breathing and heart malfunction!?
tamaranim1 [39]
Muscular dystrophy is a muscle disease that causes a loss in muscle mass and weakness. Patients with muscular dsytrophy may experience a weakening in their cardiac muscles, causings heart malfunction. Muscular dystrophy can also deteriorate the diaphragm, a muscle that solely aids in respiration, causing a breathing malfunction.
4 0
4 years ago
What is the location of carbohydrates in the cell?
son4ous [18]

Answer:

I think its cell membranes

Please correct me if I am wrong thank you

Explanation:

8 0
3 years ago
Other questions:
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Scientists initially believed that the smallest particle of matter was the atom. Then, particles smaller than the atom were disc
    7·1 answer
  • What is chlorophyll, and what is it responsible for
    11·1 answer
  • Definition: This is the generation that produces the offspring.
    8·1 answer
  • The density of an object is 3 g/cm3. the volume of the object is 5 cm3. what is the mass of the object
    14·1 answer
  • Will give 30 pts
    9·1 answer
  • 4. A woman with defective tooth enamel (autosomal recessive) and normal color vision, (X-linked) who had a color blind father wi
    10·1 answer
  • Please help me ASAP please and thank you have a wonderful day/night.
    10·2 answers
  • Earth Science B Cumulative Exam review
    14·1 answer
  • 30. The Asian country Georgia had a 2008 birthrate
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!