Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

How is coffin-lowry syndrome inherited? Do both parents need to have the disorder in order for their child to have it?

svp [43]

Answer:

Explanation:

Coffin-Lowry syndrome is caused by changes (mutations) in the RPS6KA3 gene and is inherited in an X-linked dominant pattern. Males are usually more severely affected than females.

6 0

4 years ago

Recall that two hydrogen bonds bind A and T, but three hydrogen bonds bind G and C. Because the

tensa zangetsu [6.8K]

Answer:

Explanation:

7 0

3 years ago

Read 2 more answers