1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DanielleElmas [232]
3 years ago
11

The _______ of a sound wave is defined as the amount of energy passing through a unit area of the wave front in a unit of time.

Biology
2 answers:
-Dominant- [34]3 years ago
5 0
<span>The appropriate response to the question is intensity. Sound power otherwise called acoustic force is characterized as the Energy conveyed by the sound waves per unit zone. The SI unit of force, which incorporates sound power, is the watt per square meter</span>
den301095 [7]3 years ago
5 0
<span>The correct option is C i.e intensity. The intensity of a sound wave is defined as the amount of energy passing through a unit area of the wavefront in a unit of time. It is denoted by I It is the measurement of the sound power at a particular location..It is also known as acoustic intensity.</span>
You might be interested in
How were cells discovered
ozzi

Answer:

The cell was first discovered by Robert Hooke in 1665 using a microscope. The first cell theory is credited to the work of Theodor Schwann and Matthias Jakob Schleiden in the 1830s.

8 0
3 years ago
11. Olive, fish, and avocado oil are all rich in which type of fat?
amm1812

Answer:

A: Unsaturated Fat

Have a good day:)

5 0
3 years ago
Read 2 more answers
8. One of the lowest layers of Earth's atmosphere has undergone a large increase in temperature
Kamila [148]

Answer:

Troposphere is the lowest layer of Earth’s atmosphere that has undergone a large increase in temperature due to the  presence of greenhouse gases.

Explanation:

Troposphere (0 to 12 km) where we live is the lowest layer of earth's atmosphere, which is closest to the earth's surface contains half of the atmosphere. Here most clouds are found and almost all weather occurs. Atmosphere contains approximately 78% of nitrogen , 21% of oxygen and 0.9% of argon. Gases like carbon dioxide, nitrous oxides, methane, ozone and the water vapor constitutes the rest of the atmosphere. Many small particles called aerosols are also there which include dust, spores, pollen, volcanic ash, smoke etc.The greenhouse effect is a natural phenomenon that keeps the temperature on the earth suitable for supporting life. The greenhouse gases includes both natural and man-made gases like carbon dioxide , methane, nitrous oxide, chlorofluorocarbons, hydrochlorofluorocarbons, ozone, water vapour. They absorb radiation in the atmosphere and create the green house effect. The thermal infrared radiation emitted by the Earth’s surface and the atmosphere is absorbed by greenhouse gases. They trap heat within the surface-troposphere system preventing it from escaping back into space. This is called the greenhouse effect, which increases the temperature of the lower atmosphere.The increase in the atmospheric concentrations of greenhouse gases due to human activity has caused an increase in the natural greenhouse effect. As a result, the atmosphere is trapping too much heat which increases the temperature of the Earth.

7 0
3 years ago
What are the formed elements (cell or parts of cell) in blood and what are their functions ?
STatiana [176]

Answer:

The formed elements of the blood include red blood cells (erythrocytes), white blood cells (leukocytes), and platelets (thrombocytes). Of these, leukocytes are primarily involved in the immune response. All formed elements originate in the bone marrow as stem cells (HSCs) that differentiate through hematopoiesis.

Explanation:

The formed elements of the blood include red blood cells (erythrocytes), white blood cells (leukocytes), and platelets (thrombocytes). Of these, leukocytes are primarily involved in the immune response. All formed elements originate in the bone marrow as stem cells (HSCs) that differentiate through hematopoiesis.

5 0
3 years ago
Which most directly led to the increase in food supply as part of the green revolution?
Anarel [89]

Answer:

the crossbreeding and genetic engineering of crops, such as wheat, rice, and other grains

5 0
3 years ago
Read 2 more answers
Other questions:
  • A biology student is studying ground squirrels in a local park. She has captured, measured, and released many ground squirrels f
    10·1 answer
  • What molecules both enters AND exits the Kreb's cycle?
    14·1 answer
  • A plant with round seeds is crossed with another plant with round seeds. Round are dominant over oval seeds. When two heterozygo
    15·1 answer
  • Which does erosion do?
    12·2 answers
  • The higher up the food chain humans eat, the greater levels of toxic metals they take in. true false
    14·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Plants have mitochondria and can preform cellular respiration. When would plants need to release energy by cellular respiration?
    12·1 answer
  • Why are there more marsupials in Australia than North America ?
    11·1 answer
  • Cell differentiation depends on changes in ___________ expression.
    10·2 answers
  • Plate tectonic theory states that: *
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!