1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vlada-n [284]
3 years ago
10

The graph shows the changing levels of hormones during menstruation and ovulation. What is the general trend for hormones after

ovulation as an individual approaches menstruation?
Biology
2 answers:
Salsk061 [2.6K]3 years ago
8 0

Answer:

the answer is A

Explanation:

rjkz [21]3 years ago
7 0

The general trend for hormones after ovulation as an individual when it approaches menstruation is that hormone levels generally rise. This increase levels of estrogen and progesterone would cause a negative feedback to the hypothalamus and the pituitary, which would result in the decline of the FSH and LH. BTW: Not to be TMI but i started mine and there is nothing to be scared of.

You might be interested in
What is the name of the process where a material that is weak enough to flow will rises when it is hot and sinks when it is cool
aksik [14]

Answer:

Convection process

Explanation:

The process of convection is commonly takes place in the mantle portion of the earth and also at the atmosphere.

This process is usually defined as the process where the materials are heated at a high temperature, thereby making them less denser, and due to their low density they are gradually pushed upward into the upper zones. As the materials rises up, the density gradually increases due to the lowering of the temperature, and then the materials again sinks. This give rise to the formations of a circulating cell, which are commonly known as the convection cells.

7 0
3 years ago
How do bacterial repair damaged DNA?
lukranit [14]

Answer:

Most damage to DNA is repaired by removal of the damaged bases followed by resynthesis of the excised region. Some lesions in DNA, however, can be repaired by direct reversal of the damage, which may be a more efficient way of dealing with specific types of DNA damage that occur frequently.

4 0
3 years ago
Which of the above makes up most of the muscle tissue?
BlackZzzverrR [31]

Explanation:

Proteins

<h2>Learn at brainly </h2>
5 0
1 year ago
In an effort to deal with an increasing number of immigrants
LekaFEV [45]

Answer:

Assuming that question asking the measures taken by the U. S. government in past the correct answer would be - opened a station for immigrants on Ellis Island in New York.

Explanation:

To deal with the elevation of the numbers of immigrants the U. S. government established an immigration station or point on Ellis Island located in New York City.

This station was opened in the year 1892. It was an entrance door for immigrants that come into the United States. South and Eastern Europe people were the majority of the immigrants that come these 60 years.

Thus, the correct answer is - opened a station for immigrants on Ellis Island in New York.

8 0
3 years ago
Who coined the term “Jazz Age”? A. Ernest Hemingway B. F. Scott Fitzgerald C. Sinclair Lewis D. Langston Hughes E. Duke Ellingto
Rufina [12.5K]

Scott Fitzgerald so the answer is B

3 0
3 years ago
Read 2 more answers
Other questions:
  • If we were to compare the cells in the plant leaves to the cells in the plant roots, we would expect the leaf cells to contain m
    11·1 answer
  • What would happen if cells were in mitosis more than interphase
    9·1 answer
  • The color of light that is LEAST useful to a plant during photosynthesis is
    9·1 answer
  • Sydney presents to the clinic with vulvovaginal candidiasis. appropriate treatment for her would be:
    12·1 answer
  • What is it called when a molecule moves across a semipermeable membrane into a region of high concentration?
    8·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • In a certain plant yellow leaves are dominant and red leaves are recessive. apex
    11·1 answer
  • What the best examples of fungi reproduction?
    15·2 answers
  • What is one example of how it takes energy for motion to occur?
    10·2 answers
  • Describe the terms chromosomes, genes, alleles, and DNA in relation to heredity and to each other.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!