1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
almond37 [142]
3 years ago
14

Does water cover more or less than 50% of the Earth’s surface?

Biology
1 answer:
docker41 [41]3 years ago
5 0
About 71 percent of the Earth's surface is water-covered, and the oceans hold about 96.5 percent of all Earth's water. But water also exists in the air as water vapor, in rivers and lakes, in icecaps and glaciers, in the ground as soil moisture and in aquifers, and even in you and your dog.
You might be interested in
List and explain nonspecific immune defenses in plants found in a chaparral
garik1379 [7]

Plants’ nonspecific immune responses includes cell-surface receptors (pattern recognition proteins) which allow them to identify certain patterns characteristic for pathogens.  Activated receptors trigger the production of chemical signals that may initiate both local and systemic defense responses. Sometimes when a plant is affected by infection, it triggers rapid localized programmed cell death to stop the infection further.  When it comes to defense form the herbivores, plants have physical barriers (plant cell walls and their extensions), some antibiotic compounds (phytoalexins), and even enzymes that can defend them.


6 0
2 years ago
How do limiting factors affect organisms in a community?
IceJOKER [234]

Answer:

The answer is b.

Explanation:

6 0
3 years ago
Read 2 more answers
An explanation of convection
dybincka [34]
Convection is the movement caused within a fluid by the tendency of hotter and therefore less dense material to rise, and colder, denser material to sink under the influence of gravity, which consequently results in the transfer of heat.
8 0
3 years ago
For photoperiodism to occur a plant must use which of the following photosensitive pigments?. . A.polychrome. B.phytochrome. C.p
elixir [45]
I think the correct answer among the choices listed above is option B. For photoperiodism to occur, a plant must use a phytochrome. This is a pigment that plants use to detect light. It is sensitive to light in the red region. Hope this answers the question.
3 0
3 years ago
Read 2 more answers
Which phase of the Moon will appear 14 days after the moon phase below?
Wewaii [24]

Answer:

The Full Moon Phase

Explanation:

After 14 days, the moon is 180 degrees away from the Sun, with the Sun, Earth and Moon, forming a straight line. The moon would completely be illuminated by the Sun. Hence, this is called the “full moon phase.” This is the only time during the entire month when the Earth's shadow could be close to the moon.

6 0
2 years ago
Other questions:
  • What happens to a ray of light that passes through a lens?
    9·2 answers
  • Just a question, since its Friday.
    11·1 answer
  • The coral never holds quite the pink I hope for and fish continue to catch strange sickness like the angel fish, Greta who has a
    13·2 answers
  • should insurance companies have the right to learn the genetic profiles of the people they insure? Why or why not? Give three re
    10·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Compare the organization of DNA in prokaryotic and eukaryotic cells
    6·1 answer
  • What is the role of the fox?
    6·2 answers
  • In which way Copernicus changed the way people viewed the solar system?
    15·1 answer
  • Which bird is best adapted to live in a watery environment?
    9·1 answer
  • Many different relationships exist between organisms in an ecosystem. These relationships include competition for food, shelter,
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!