1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Illusion [34]
4 years ago
15

What is the Number of bonds formed in muscle

Biology
1 answer:
vovangra [49]4 years ago
8 0

Answer:

there are three.

Explanation:

You might be interested in
Type the correct answer in the box. Spell the word correctly. How do X linked diseases affect females? In case of X linked disea
ahrayia [7]
Carriers of the disease
3 0
3 years ago
Read 2 more answers
One of the ways that food can be preserved is by heavily salting it so that bacteria cannot live upon the food. What causes the
Marina CMI [18]

Answer:

Dehydration

Explanation:

What causes bacteria to die in an extremely salty environment is dehydration due to the loss of osmotic balance in their cells.

Water molecules would normally move from the region of high water potential or low solute concentration to the region of low water potential or high solute concentration through a biologically permeable membrane.

<em>An extremely salty environment would be hypertonic to the cells of bacteria and the cell walls of bacteria act as biologically permeable membranes. Hence, the bacteria cells lose water due to the osmotic movement of water from their cells to the surrounding salty environment. </em>

4 0
3 years ago
You find a beaker filled with an unknown clear liquid on your lab bench. what should you do?
Anastaziya [24]
Treat the liquid as if it is hazardous. Inform your teacher/instructor so you will be notified of the proper disposal technique.
8 0
3 years ago
In addition to being necessary for respiration, _______ also provides UV radiation protection.
Semmy [17]
The correct answer is B. Oxygen.

Oxygen, as a part of the atmosphere, also participates in UV protection, besides being necessary for breathing.
3 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Other questions:
  • Butene has two isomers—one with methyl groups on the same side of the double bond and the other with methyl groups on the opposi
    15·1 answer
  • Water pressure in stems and leaves helps to
    8·2 answers
  • Adaptors are _____.
    8·2 answers
  • Which activity can occur without the use of
    9·2 answers
  • What do cells need to do between divisions to make sure they don't just get smaller and smaller.
    6·1 answer
  • What moves through the community from one trophic level to another as organisms feed on one another?What moves through the commu
    6·1 answer
  • Scientists were. about whether dolphins could be used as therapy animals
    6·1 answer
  • How do you fix boredom?(trick question)
    5·2 answers
  • Which of the following is the best definition for the process of photosynthesis?
    8·2 answers
  • How does an influenza virus cause symptoms of the flu to spread in the<br> human body
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!