1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MatroZZZ [7]
4 years ago
10

A major function of a plant's roots is to...???

Biology
1 answer:
tiny-mole [99]4 years ago
7 0

A major function of the roots of a plant is to absorb water to produce food for the organism. They need water to produce the glucose product of food, the other reactant is carbon dioxide. This is the process of photosynthesis. The other product is oxygen

- Oxygen, substance all organisms require to survive.

- Glucose, substance produced and used by plant organisms for food.

- Reactant, substances used to make products.

- Carbon Dioxide, gas found floating in air, used by plants to make oxygen.

- Photosynthesis, the process where plants use their chlorophyll to make substances like food

Hope this helps, if not, comment below please!!!!!

You might be interested in
What is a natural cycle
Helga [31]

Answer:

Natural cycle: a natural process which regulates Earth's systems. Solar cycle: changes in the amount of activity on the sun's surface. Carbon dioxide goes through natural cycles over hundreds of thousands of years. ... Earth goes through many natural cycles and climate is no exception.

Explanation:

5 0
3 years ago
Why is silkworm called the queen of insects
vova2212 [387]

Answer:

Silk is a highly economic fiber, with a unit of raw silk worth about twenty times the value of raw cotton. Aside from silk, these insects are used to feed pets, apparently the healthiest natural food source. ... The above economic and health benefits, not an exhaustive list, justifies the title of queen of insects.

4 0
3 years ago
Read 2 more answers
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
juan earn $11 per hour and works at most 30 hours per week. identify the independent and dependent quantity in the situation, an
Vlad [161]

Answer:

  1. <u>The hours are the independent variable.</u>
  2. <u>The wages/wk earned are ( $11/hr )x( hrs worked ) . This is the dependent variable ( depends on hours worked ) .</u>
  3. <u>The domain is 0 to 30 </u>
  4. <u>The range is 0 to 330 </u>

Explanation:

<em>The hours are the independent variable and  should be plotted on the x-axis .</em>

<em>The wages/wk earned are ( $11/hr )x( hrs worked ) . This is the dependent variable ( depends on hours worked )  and should be plotted on the y-axis </em>

<em>--------------- </em>

<em>Let +W+ = wages/wk earned </em>

<em></em>

<em>Let +h+ = hours/wk worked </em>

<em>The equation is: </em>

<em>+W+=+11h+ </em>

<em>The domain is 0 to 30 </em>

<em>( no hrs worked to 30 hrs worked ) </em>

<em>The range is 0 to 330 </em>

<em>( no wages eared to +11%2A30+=+330+ earned )</em>

7 0
3 years ago
Which of the following would NOT be considered Lamarckian ideas about evolution?
wolverine [178]

Answer:

noelos

Explanation:

6 0
3 years ago
Other questions:
  • Use the information and your knowledge of science to answer the question.
    8·1 answer
  • In contrast to adults, cardiac arrest in children is usually caused by
    6·1 answer
  • Explain why some archaea are known as extremophiles. describe the distinguishing features of extreme halophiles and extreme ther
    11·1 answer
  • For a human zygote to become an embryo, it must undergo what
    9·1 answer
  • Quanto mais aprendemos, maior nosso cérebro fica? (com prefencia, dê referencias bibliográficas)
    15·1 answer
  • What will happen if water vapor decreased ?
    10·1 answer
  • SCIENCE
    9·2 answers
  • Plant and animal cells both have cell membranes<br><br> True<br> Or<br> False
    8·1 answer
  • Use the words, DNA, chromosome, and gene in a sentence.
    12·1 answer
  • if your family produces an average of 1.8kg of solid waste per person per day, how much waste will your entire family generate i
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!