1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xeze [42]
3 years ago
10

What does the small intestine do in the digestive system?

Biology
1 answer:
Montano1993 [528]3 years ago
7 0
<span>is absorption of nutrients and minerals from food.</span>
You might be interested in
based on your observation, you suggest that the presence of water could accelerate the growth of bread mold
Marta_Voda [28]
Molds and fungi are found everywhere inside and outside, and can grow on almost any substance when moisture is present. Molds when they reproduce make spores, which can be carried by air currents. When these spores land on a moist surface that is suitable for life, they begin to grow. Molds are essential to the natural breakdown of organic materials in the environment. Mold is normally found indoors at levels that do not affect most healthy individuals. When these levels become abnormally high as determined by indoor air quality testing or a mold inspection, remediation is recommended to be carried out by a professional remediation company.
6 0
4 years ago
5. A gene has a base sequence of GTC. Due to a mutation, the base sequence changes to GTG. Answer the following questions using
Dafna11 [192]
For B. It is CAC
For the rest there needs to be a codon table for us to see

5 0
3 years ago
Human _____ was the first product made by genetic engineering to be marketed
son4ous [18]
Genome project or DNA
3 0
4 years ago
Read 2 more answers
In a ecosystem which of the following is a trait of living organisms
vlada-n [284]

Answer:

All of the living organisms have the ability to adapt.

Explanation:

4 0
3 years ago
Why biology is important for the welfare of human beings?Give reasons
Ierofanga [76]

Answer:

as the field of science, biology help as to understand the living world and the ways it's many species

8 0
3 years ago
Other questions:
  • Which bones are considered part of the pelvic girdle but are not considered part of the appendicular skeleton?
    13·2 answers
  • Which is the most accurate description of a leaf or your stomach?
    10·2 answers
  • PLEASE HELP MEEE
    10·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which example describes an abiotic factor interacting with a biotic factor?
    15·1 answer
  • Which of the following statement is true of a semi-conservative model of replication?
    10·2 answers
  • Hey Guys! ^^ Here's A Question, Why does a dog circle around its bed before lying down?
    9·1 answer
  • What are 2 stages of photosynthesis, and where does it take place?
    12·1 answer
  • 1 point
    7·1 answer
  • What is the origin of the sunflower?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!