1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirill115 [55]
3 years ago
12

Question 4 of 25

Mathematics
1 answer:
Ronch [10]3 years ago
7 0

Answer:

The answer is B

Step-by-step explanation:

As polynomial means "many".

So, the power of expression must be greater than 1 (e.g. x², x⁵, x⁷)

You might be interested in
Solve and graph: -x+8<6
d1i1m1o1n [39]

Answer:

Following given solution will help you!

3 0
3 years ago
How do I find the volume of the cylinder round to the nearest hundredths ​
Zigmanuir [339]

Answer:

Volume = 502.65 cm³

Step-by-step explanation:

V= 3.14×4²×10 = 502.65 cm³

8 0
2 years ago
al made a treehouse last summer. He started by making a model. the model included a window with height 1/3 inch. and width 1/6 i
IrinaK [193]

Answer:

27

Step-by-step explanation:

4 0
3 years ago
Tamela feeds her finches 1 cup of food for every three birds in the cage. She writes
FrozenT [24]

Answer:

c=1/3F

Step-by-step explanation:

7 0
3 years ago
How do I graph g(x)=f(x)+5
sashaice [31]
Find the absolute value vertex. In this case, the vertex for y=|x−5|y=|x-5| is (5,0)(5,0).

(5,0)(5,0)

The domain of the expression is all real numbers except where the expression is undefined. In this case, there is no real number that makes the expression undefined.

(−∞,∞)(-∞,∞)

{x|x∈R}{x|x∈ℝ}

For each xx value, there is one yy value. Select few xx values from the domain. It would be more useful to select the values so that they are around the xx value of the absolute valuevertex.

xy3241506172

8 0
3 years ago
Other questions:
  • 128 more than the product of v and 25 is the same as v
    12·1 answer
  • Polygon ABCD is the result of a translation of polygon EFGH . AB¯¯¯¯¯ is parallel to DC¯¯¯¯¯ in the pre-image. Drag the answers
    14·2 answers
  • The perimeter of a square is 44cm. use an equation to find the length and side​
    12·1 answer
  • Order the terms p2, p4, p3, and p in a descending powers of p
    6·1 answer
  • Look at the picture attached
    5·1 answer
  • How can you could use the distributive property and mentality to find 5×198
    9·2 answers
  • 18-20 are these correct <br> Last ones!!!!!
    13·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Multiply the expression 2y√2y^ by the expression 4√5y, and write the expression in simplified radical form.
    12·1 answer
  • Please help me with this problem. I'm kind of stuck and don't know what to do.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!