1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BARSIC [14]
4 years ago
11

If the membrane potential at the axon hillock becomes subthreshold, an action potential will be fired.

Biology
1 answer:
CaHeK987 [17]4 years ago
4 0

Answer:

False

Explanation:

Action potential will only be fired when the memebrane potential is above the threshold level.

This follows the all-none -principle.

No matter the strenght of stimulus if the magnitride is not upto the threshold level,No action potential will.be generated.

An example is the flushing of water closet or lavoratory.No mater one tried to flush,if the water in the closet does not fill up to the threshold for flushing,,to propel flushing. not flushing will take place.

You might be interested in
30 POINTS<br><br> I NEED 6 CHARACTERISTICS OF BIODIVIRSITY!!!! MUST BE COMPLETE SENTENCES!!!!!!!
sukhopar [10]
The variety of organisms that occupy a given region including microscopic protists to large mammals. The region can be a political unit such as a country a geographic feature such as a mountain range or the entire world. The first level of bio diversity is genetic diversity. Next is taxonomic diversity. Also ecological diversity.
7 0
3 years ago
zerem e, imamović g, omerović s: simple renal cysts and arterial hypertension: does their evacuation decrease the blood pressure
AveGali [126]

Kidney cysts appear in one-third of adults older than 50. There are various causes of renal cystic disease, even though the majority are simple cysts. Cystic illness can be categorized broadly.

<h3>What is Renal Cyst ?</h3>

The cortical or medullary renal tubules are the main sites of renal cysts, which are spherical, thin-walled, variable in size distentions that are filled with a clear, watery fluid. Congenital renal cysts can develop on their own or as a result of renal dysfunction. Primary renal cysts' pathophysiology is not fully known.

When the tube of a nephron starts to enlarge and fill with fluid, kidney cysts develop. While the source of this is unknown, researchers do know that small cysts are not hereditary. Simple kidney cysts are thought to arise as a result of damage to the tubules or microscopic obstructions therein.

<h3>What is Arterial Hypertension ?</h3>

In the illness known as pulmonary arterial hypertension (PAH), which has a mortality rate of 15% year, pulmonary arterial blockage increases pulmonary vascular resistance.

Renal illness diabetes. chronic kidney infections Obstructive sleep apnoea occurs when the throat's muscles relax and constrict while you're sleeping, preventing you from breathing normally.

<h3>What is Blood Pressure ?</h3>

The force of moving blood exerted on the walls of blood arteries is known as blood pressure. The heart's action of pumping blood through the circulatory system is mostly responsible for this pressure. The pressure in the major arteries is meant when the word "blood pressure" is used without qualifier.

To know more about Renal Cyst please click here : brainly.com/question/26697997

#SPJ4

4 0
2 years ago
A zygote is produced by meiosis.<br><br> True<br> False
sweet-ann [11.9K]

The given statement is true.

In humans all reproduction is sexual, it comprises a combination of haploid gamete cells from each parent with half the usual number of chromosomes to produce a novel cell comprising genetic material of both the parents, This is known as a diploid zygote.

When the gametes combine they produce a cell known as a zygote. Human eggs and sperm comprise 23 chromosomes. The human zygotes comprise 46 chromosomes. The kind of cell differentiation, which generates gametes with half the usual number of chromosome is known as meiosis.


4 0
3 years ago
The sequence of nucleotides in an mRNA is 5’AUGACCCAUUGGUCUCGUUGGCUGAAGUCA 3’.
jekas [21]

Answer:

Ths change represents a mutation of tryptophan (W) to a stop codon: W  to a stop codon  

Explanation:

Messenger RNAand protein sequence (below):

AUG ACC CAU UGG UCU CGU UGA CUG AAG UCA

  M     T      H      W       S      R     " W  "   L        K      S

Since the mutagen changes the sequence to produce a stop codon at position 20 of the DNA, it is expected the following polypeptide sequence:

AUG ACC CAU UGG UCU CGU UGA CUG AAG UCA

  M      T      H      W       S      R       -  

Stop codons such as UAG, UAA and UGA mark the end of the protein coding sequence

3 0
3 years ago
Read 2 more answers
What are the three of vegetative propagation of turfgrasses?
alexgriva [62]
Sod, plugging, sprigging, and stolons<span>.</span>
7 0
4 years ago
Other questions:
  • Summarize the process of DNA replication in the purpose. ASAP ( 15 points)
    13·1 answer
  • Which sentence is a run-on?
    15·2 answers
  • ​the process by which bile acts on fat so that enzymes can attack the fat is known as ____.
    5·1 answer
  • Will give brainliest plz help <br> Answer 12 plz
    7·1 answer
  • What will happen if external factors affect cell division in a group of cells placed in a culture dish? A) Anchorage dependence
    11·1 answer
  • Please put in order from smallest to largest (PLEASE HELP IM CRYING!!!!) ​
    8·1 answer
  • What is a scientific model?
    11·1 answer
  • How long would it take for the bacteria population to increase from 500 to 1,000 bacteria?
    12·2 answers
  • Specific proteins produced in a cell are directly related to the A. Number of mitochondria in the cell. B. Sequence of sugars an
    11·1 answer
  • If some organisms can reproduce asexually why is sexual reproduction still necessary?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!