1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GrogVix [38]
3 years ago
5

What phenotypic ratio would you expect as a result of a test cross between two individuals where 9) one that is homozygous reces

sive for alleles at two independent loci?

Biology
1 answer:
olasank [31]3 years ago
8 0

What phenotypic ratio would you expect as a result of a test cross between a dihybrid organism and one that is homozygous recessive for alleles at two independent loci?

a. 3:1

b. 9:3:3:1

c. 1:1:1:1

d. 1:2:1

e. 9:4:2:1

Answer:

c. 1:1:1:1

Explanation:

When a heterozygous individual for two genes is test crossed with a double homozygous recessive individual, the progeny is obtained in 1:1:1:1 phenotypic ratio. This occurs as the heterozygous dominant individual forms four types of gametes in 1:1:1:1 ratio while the homozygous recessive individual would form only one type of gamete having one recessive allele for each gene.  

For example, a test cross between TtRr (tall and red) and ttrr (short and white) would produce a progeny in following ratio=

1 tall, red: 1 tall, white: 1 short, red: 1 short, white

Here, T= tall, t= short, R= red, r= white

You might be interested in
landscape management attracts people to nature preserves and national parks what are the benefits to the wildlife in these areas
Ket [755]

Answer:

one benefits to wildlife in national and nature parks are, that there are is not hunting within the parks. not only does this protect the wildlife, it also sustains the balance of life. nature and wildlife parks allow a careful eye to be placed on the animals that are going extinct or are even victims of severe hunting. this allows this generation as well as their future offspring to be healthy and ensure safety. a benefit to the public would be the, scenic routes you can walk on a trail, besides walking and being outdoors, any contribution/ donations are ensured to go towards rehabilitation of the animals.

Explanation:

i made it up and it gave me 100%

3 0
3 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Describe how each layer of the earth is different based on its density and chemical composition.
MrRa [10]
Each layer of earth has a different density the more in you go with the layers the more density is going to show up.
Crust-2.2g/cm^3
Upper mantle-3.4g/cm^3
Lower mantle-4.4g/cm^3
Outer core-9.9g/cm^3
Inner core-12.8g/cm^3

Hope I helped in something, Sorry if I didn't gave it my best shot:)
7 0
3 years ago
The human body stores chemical energy from digested food some of the chemical energy is converted into mechanical energy when th
babymother [125]

Answer:

<em>Digested food is a source of potential energy</em>

Explanation:

When we digest food, the molecules of the food are broken down into smaller compounds. Chemical energy is released due to this process. Chemical energy can be used to form glucose and fat. These molecules store energy in them. When energy is required by the body, the glucose molecules can be converted into ATP and hence give energy. This energy can be used for various purposes such as it can be converted into mechanical energy for muscle movements.

8 0
3 years ago
What would happen to the ecosystem when a keystone species, such as a wolf, is removed
andrew-mc [135]
This would affect the population of the rabbits isf this happens the increase of population on the rabbits then if theres an increase on the rabiits then there will be a limiting factor of food for them this will affect the carraying capacity of the ecosystem
5 0
3 years ago
Other questions:
  • Ideally, a group's size should be _______________.
    6·1 answer
  • Suppose a gene has three exons, with 570 nucleotides in exon 1, 420 in exon 2, and 810 in exon 3. there is a variant in which ex
    8·1 answer
  • Earth. 1. A
    7·1 answer
  • Classify as man-made or natural extinction: Pollution
    12·1 answer
  • When a volcano erupts, such as the Kilauea volcano in Hawaii, what do you think happens to the surrounding ecosystem? Explain ho
    15·1 answer
  • What is the purpose of colorful petals?
    5·2 answers
  • Plants have many characteristics.
    13·1 answer
  • Imagine that certain laws of physics could be ignored and you were able to
    8·1 answer
  • Cubozoans can be found in which life stage
    11·1 answer
  • If the area had experienced a wet season two years after the drought instead of a dry season,
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!