1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
guajiro [1.7K]
3 years ago
13

If Gloria gets violently ill a couple of hours after eating contaminated food, she will probably develop an aversion to the tast

e of that food but not to the sight of the restaurant where she ate or to the sound of the music she heard there. This illustrates that associative learning is constrained by _____ predispositions.
Biology
1 answer:
Lena [83]3 years ago
8 0

Answer:

Biological predispositions

Explanation:

A Biological Predisposition is an expanded possibility of building up an infection or example of conduct dependent on the qualities we acquired from our folks (and our's folks). Qualities impact our character attributes, our IQ, our probability of getting malignant growth, and even our odds of turning into a heavy drinker.

Being predisposed to a turmoil doesn't imply that we will create it, just that we are progressively powerless against it dependent on our hereditary cosmetics. Natural hazard variables join with ecological factors, for example, stress or diet to trigger a confusion.

Research studies utilizing twins have demonstrated that numerous attributes and disarranges are heritable. For instance, in indistinguishable twin sets, on the off chance that one twin is determined to have schizophrenia, there is a half shot that the other twin will likewise be analyzed. Be that as it may, in congenial twin matches, this rate is just 15%. Since indistinguishable twins share a larger number of qualities than brotherly twins, we can infer that schizophrenia has an acquired organic premise.

You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Alfred has a golden retriever named Max. Max can recognize people from their smell. Max starts to bark and wag his tail when Alf
Ipatiy [6.2K]
The answer is b thank and rate my answer for 30 points they come in in 35 minutes
8 0
3 years ago
Read 2 more answers
What are some examples of environmental resources?
Gemiola [76]
Hi there!

Here are some examples of Enviormental resources:

#1 Coal

#2 Gold

#3 Gas

#4 Iron

#5 Copper

#6 Petroleum

Hope this helps you!

~DL ☆☆☆
4 0
3 years ago
Read 2 more answers
In a recent murder mystery, a woman died in minutes after consuming cyanide-laced sugar (glucose). Forensic scientists did some
AURORKA [14]

Answer:

<h2>Mitochondria was affected by the poison cellular respiration </h2>

<h3>Hope it helps you </h3>
6 0
2 years ago
The experiment that Stanley L Miller and Harold C Urey conducted regarding the origin of life from inanimate matter was conducte
nignag [31]
For giving you understanding ; we need Free O2 but Oxygen is also available in H20 right why dont we use it !!

As the early atmosphere was reducing as there was no free oxygen but it was later produced by chemoautotrophic bacteria !! Living thing release O2 in atmosphere thus making it oxidising in nature and then life evolves !!
4 0
3 years ago
Read 2 more answers
Other questions:
  • Describe the steps to transcribe an mRNA molecule and use the mRNA molecule to produce proteins.
    12·1 answer
  • Pyruvatic acids are formed during which stage of cellular respiration?
    14·2 answers
  • Based on the pyramid which type of organism would be least abundant in most ecosystems
    15·1 answer
  • The pathology report for a patient with penile cancer has this statement: The tumor involves the shaft of the penis. The cancer
    15·1 answer
  • Please help <br> Dominant or recessive<br> And what is Ann’s genotype?
    8·1 answer
  • In which element does an aquatic plant grow in?
    8·1 answer
  • When homologous chromosomes cross over, what occurs?
    11·2 answers
  • Come all bad girls to see and show<br><br>sks-zuqt-wjw<br><br>come only that girls who are h ot​
    12·2 answers
  • In this same forest ecosystem mentioned above, what are one possible reason the wolf population might decline?
    5·1 answer
  • Construct a brief argument to refute Cal’s claim in the following scenario.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!