1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frozen [14]
3 years ago
11

Plants are used on slopes to prevent erosion. Which of these plants would be the best choice to plant on a slope to provide eros

ion control?
A. dandelions
B. grass
C. oak trees
D. hickory trees
Biology
1 answer:
tiny-mole [99]3 years ago
8 0
The answer is C. Oak trees
You might be interested in
I don’t know if you can see the answers but I really need help on it
aleksklad [387]
I think it is A because they can just destroy it but D is finding something natural to kill it off but it is GM so it wouldn't help so A
7 0
3 years ago
What forms blood clots
bija089 [108]
Blood clots form when platelets and plasma proteins thicken to form a sort of solid mass. They can form from an injury, blood flowing slowly through your system, or even for no obvious reason. 
7 0
3 years ago
How do glycolysis, pyruvate processing, the Krebs cycle, and the electron transport chain work together to provide energy for th
Ivahew [28]

When the cell gains glucose, the process of glycolysis occurs and then the glucose is broken down into pyruvate.  

Now, in pyruvate processing, Acetyl CoA is produced and used in the Krebs Cycle.

During that process, NADH and FADH2 are made and go into the electron transport chain. That is where water and ATP are made.

8 0
3 years ago
Which best describes the flow of genetic information. A= genetic information is carried only by dna. B= genetic information flow
alexandr1967 [171]
The answer is C=genetic information flows from DNA to RNA to protein
6 0
3 years ago
Read 2 more answers
What must happen for scientific theories to be accepted as valid? (5 points)
natka813 [3]

Answer:

scientific theories must be tested by more than one individual multiply times for it to become scientific law

7 0
2 years ago
Other questions:
  • Hi harshika<br>answer fast​
    10·1 answer
  • One cat carries heterozygous dominant, long-haired traits, and its mate carries homozygous recessive short-haired traits. Use a
    12·1 answer
  • Which gas is the most abundant in our atmosphere?
    10·2 answers
  • Assume that you work in criminal investigation unit and were called for an incident that involved someone who was shot. You arri
    7·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Why is equilibrium important to a star
    6·1 answer
  • explain what would happen to the system if anthropogenic carbon was to continue to increase in the system
    10·1 answer
  • As you have been working in class today, the breathing center in the brain responds to the level of carbon
    7·2 answers
  • A catalyst is a ______.
    7·2 answers
  • 6.<br><br> Evolution explains how variations can lead to changes in a species
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!