<span>The correct answer is A, B and D. Biogeochemical cycles are central to the ecology of earth system. They make the essentail elements accessible and available for the organisms, and maintain their levels, so that the ecology is ot disrupted. The elements move through abiotic and biotic factors, in these cycles, and a state of equilibrium is maintained n the ecosystem. The carbon dioxide levels are responsible fr the temperature of the earth. If Carbon cycles would not have existed, then there would have been a disruption in maintaining the global temperature. Biogeochemical cycles basically continuously recycles the essential materials, for sustaining the life-forms.</span>
Answer:
BRAINLIEST PLZZZ
Explanation:
They play a major role in protein synthesis. They act as the powerhouse for the cell. They are involved in the separation of chromosomes during cell division.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
I guess you forgot to add the picture or so.
Based on the Complementarity of the 4 nucleotides, The thymine must always be placed in front of the Adenine, and the Cytosine must always be placed in front of the Guanine.
Any change in this rule causes the deformation of the DNA, and can sometimes cause fatal diseases like the melanoma (skin cancer) etc...
Hope this Helps! :)
Answer:
92.
Explanation:
92 chromatids are visible for humans at prophase stage because the replication of 46 chromosomes occur. When the replication of chromosomes occur, each chromosome is converted into two chromatids so when 46 chromosomes replication occur then it changed into 92 chromatids. So we can say that there is 92 chromatids in humans in the prophase stage of mitosis.
