1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ra1l [238]
2 years ago
5

Which of the following explains how polar molecules form

Biology
1 answer:
n200080 [17]2 years ago
3 0

Answer:

D. Electrons are more attracted to one of the atoms involved in a bond.

You might be interested in
PLEASE HELP WITH THIS ONE QUESTION
PSYCHO15rus [73]

Answer:

D

Explanation:

as only one phosphate is removed hence the name ADP which stands for adenineDIphosphate. Hope this make sense :)

4 0
2 years ago
Which scientist is matched with his contribution to evolutionary theory
jekas [21]
The scieintist is Charles Darwin.
5 0
3 years ago
Why is it important to ask a person who has an insect sting if they have had any prior serious reactions to insect stings
zloy xaker [14]

It is important to ask about the reactions caused by an insect bite because this will allow you to act quickly if there are health effects.

<h3>What is an insect sting?</h3>

The insect sting is the way in which insects defend themselves when they feel attacked by other organisms. Insects generally have stingers or spikes on their bodies to defend themselves against predators.

<h3>Why is it important to be aware of the effects of a sting?</h3>

When a person suffers a sting, it is necessary to report all the symptoms that they experience because some insects have substances that affect the body and can cause allergic reactions that put the health and life of the individual at risk.

Learn more about insect sting in: brainly.com/question/6054154

3 0
2 years ago
What can you tell about an igneous rock that has a fine texture?
alukav5142 [94]

Answer:c

Explanation:it is most likely extrusive

5 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Other questions:
  • (d) Referring to Figure 1B, explain why any newly synthesized strand of DNA is the result of both continuous and discontinuous D
    14·1 answer
  • Is the nucleotide in the picture a DNA nucleotide or an RNA nucleotide? How can you tell?
    5·1 answer
  • John has been studying classification in class. He learned that Aristotle was the first to classify organisms. Aristotle classif
    12·1 answer
  • Dlaczego ryby i płazy mają skórę pokrytą śluzem ?
    5·1 answer
  • Mario recently earned his Ph.D. in biochemistry and has been asked to join a lab at a prestigious university. After a month on t
    14·1 answer
  • This geographic feature gave rise to early civilization.
    10·2 answers
  • How can an increase in biodiversity lead to an increase in ecosystem stability?
    7·2 answers
  • Why is freedom a concern for creationists?
    12·1 answer
  • Which of the following food groups does the food produced belong?
    14·2 answers
  • Select the correct statement regarding a chemical synapse.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!