1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
djyliett [7]
3 years ago
8

Difference between an alcohol and an ether?

Biology
1 answer:
Pani-rosa [81]3 years ago
8 0

Answer:

The fundamental difference between these compounds is the presence of OH groups in the alcohol that are missing in the ether. Because hydrogen bonds can't form between the molecules in the ether, the boiling point of this compound is more than 80°C lower than the corresponding alcohol.

You might be interested in
1 Write the functions of the following:
PolarNik [594]
1a. Pseudopodia means false feet these are irregular projections found in organisms like amoeba,they help the organism in locomotion capture food etc
1b.a good vacuole is a membrane-enclosed cell vacuole with a digestive system,containing material taken up in by the process of phagocytosis.these are found in amoeba,Protozoa,paramecium
2.the ingestion of bacteria or other material by phagocytes and amoeboid protozoans (wasn’t sure for this one so I had to research)
3.amoeba takes in nutrition by the process called phagocytosis.in this process,a solid food particle is first surrounded by pseudopodia (cytoplasmic filled projection of cell membrane) and forms a vacuole called as Phagosome

Please mark me as brainliest or please say this is helpful

I hope this helps if you have any more questions just message me
3 0
2 years ago
One strand of dna is 5' - aggcctta - 3'. what is the opposite strand?
Natalija [7]
TCCGGAAT I hope that helps.
5 0
2 years ago
What is the role of splindle fibers in mitosis​
UkoKoshka [18]

Answer:

Spindle fibers form a protein structure that divides the genetic material in a cell. The spindle is necessary to equally divide the chromosomes in a parental cell into two daughter cells during both types of nuclear division: mitosis and meiosis. During mitosis, the spindle fibers are called the mitotic spindle.

Explanation:

8 0
3 years ago
What type of muscle tissue is pictured?
Dafna11 [192]

Answer:

Smooth muscle tissue

Explanation:

In the diagram it can show you. It is the one in the middle!

Hope this helped!

4 0
2 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Other questions:
  • Have you ever sat around a campfire or watched flames flicker in a fireplace? The burning of wood is a chemical reaction. A chem
    9·1 answer
  • Name the two different types of tissue in the transport system of a flowering plant
    13·1 answer
  • the first hominine in the genus homo was named homo habilis because evidence indicates the member of the species used
    5·2 answers
  • All land plants produce _______ by mitosis and _______ by meiosis.
    6·1 answer
  • Which ter cell that provides transport as its main function? cell membrane endoplasmic reticulum centriole cell wall
    9·2 answers
  • Each transfer RNA requires at least four specific recognition sites that must be inherent in its tertiary structure in order for
    12·1 answer
  • During the replication of DNA, __________.
    13·1 answer
  • 2. In dogs, there is a hereditary type of deafness caused by a recessive gene. Two dogs who carry the
    15·2 answers
  • How do Limiting factors affect biotic potential? Please hurry and help me
    14·1 answer
  • What are all of the biotic and abiotic things that interact in a particular
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!