1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kitty [74]
3 years ago
11

Please please helppppp!!!!!!

Biology
2 answers:
N76 [4]3 years ago
8 0
The answer to the question is C because when water turns into ice, the atoms come together to form a solid liquid.
inn [45]3 years ago
7 0
C is the answer to the question
You might be interested in
WHat is the growth rate births=20 deaths=10 immigrantion=5 emigration=1
gizmo_the_mogwai [7]

Answer:

6

Explanation:

20-10=10

5-1=4

10-4=6

8 0
3 years ago
What ideas were changing in the scientific community at the time Darwin travels
Stels [109]

Answer:

One Idea was the appreciation that the age of the Earth was much greater than had hitherto for been imagined.

6 0
3 years ago
Clams, octopuses, and snails are classified together in the same phylum, which is the phylum Mollusca. Are these animal groups a
vagabundo [1.1K]

Answer:

A. Yes. All phylum members are classified together in the same kingdom

Explanation:

This because there are two broad classification of living organisms which are plants kingdom and animal kingdom which have several subdivisions under each. The phylum molluscs is under the animal kingdom because all the organism present under it are animals. The group consist of majorly eukaryotic, multicellular organisms that are heterotrophic in nature.

4 0
3 years ago
How is human activity related to carbon dioxide concentrations in the atmosphere?
Alexandra [31]

The answer is A hope this helps

3 0
3 years ago
Read 2 more answers
you find that some cells have twice the amount of DNA in their nuclei as other cells do. What might you conclude?
Pie
They might be going through the S Phase of the cell cycle which is DNA replication. Usually, when the cells go through this phase they end up to dividing.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Describe how human activities have affected the worlds major terrestrial freshwater and marine ecosystem
    10·1 answer
  • How corona virus affected environment?
    9·2 answers
  • Which of these observations illustrate the developmental plasticity of the human nervous system?
    14·1 answer
  • ________ is a drug that blocks cell division by stabilizing microtubules; as a result, it is used in the treatment of ________.
    6·1 answer
  • Is there a way in which solar energy can be harnessed for use by humans directly? How can you relate this to the first law of th
    7·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which organism is best classified as a consumer?
    5·1 answer
  • Which statement best summarizes how human lifestyles are currently affecting the sustainability of resources on Earth?
    8·1 answer
  • Sometimes an organ can be replaced by moving it from one part of the body to another. This can be done, for example, to replace
    14·1 answer
  • During an ____________ contraction, the muscle develops tension without changing in length.An isometric contraction occurs at th
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!