1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naily [24]
3 years ago
7

Which of the following is not an essential role of the liver? Which of the following is not an essential role of the liver? prot

ein metabolism urea disposal biotransformation functions carbohydrate metabolism
Biology
1 answer:
True [87]3 years ago
6 0

Answer: urea disposal

Explanation:

<u>The liver, which is the largest organ in the human body, performs three vital functions of the organism: detoxification, synthesis and storage. </u>

The liver acts as an authentic filter that collects and eliminates numerous toxins, such as ammonia, or toxins that we ingest, such as alcohol (it performs a biotransformation of toxins). Our liver is also responsible for the metabolism of carbohydrates, lipids and proteins, secreting bile, an essential element for the digestion. It also prevents bleeding through a coagulation process. And it is a container of vitamins (A, D, E, K) and glycogen (carbohydrates), while energy is stored in the form of sugar, made available to our organization.

The urea cycle takes place primarily in the liver. Organisms convert ammonia to a less toxic substance, such as urea, via the urea cycle. <u>Then it is released into the bloodstream where it travels to the kidneys and is ultimately excreted in urine. </u>

So, the liver is involved in the production of urea, but the kidney is responsible of its disposal.

You might be interested in
What are the highest clouds in the atmosphere?
Aleks04 [339]
<span>Noctilucent clouds (sometimes known as night clouds or mesopheric clouds) form in the mesosphere, a layer of the atmosphere located 47-59 miles above the Earth. </span>
5 0
3 years ago
Emma lives in Wisconsin and wants to plant geraniums in her yard. The average daily temperature in her area is 21°C (70°F) and t
AnnyKZ [126]

Answer: no

Explanation:

4 0
2 years ago
The gonads are reproductive organs responsible for the production of
ASHA 777 [7]

Answer:

The gonads are reproductive organs responsible for the production of <u>gametes (sex cells) in their external secretion and in their internal secretion, hormones that exert their action on the organs involved in reproductive function.</u>

Explanation:

Gonads are glands that are part of two body systems: the endocrine system and the reproductive system; and there are two types of gonads: male and female, the first are the testicles and the second the ovaries and both produce steroid hormones (derived from cholesterol) exactly the same as those produced by the cortex of the adrenal glands.

8 0
3 years ago
True or false, thermic effect of food is the amount of energy expended above rmr as a result of the processing of food (digestio
kati45 [8]
Http://www.flashcardmachine.com/nutrition-exam33.html 
This I think definitely will help :)
8 0
3 years ago
What is the ONLY organ located in the region (umbilical)?
Vitek1552 [10]

Answer:

small intestine

Explanation:

Umbilical. The umbilical region contains the umbilicus (navel), and many parts of the small intestine, such as part of the duodenum, the jejunum, and the illeum. It also contains the transverse colon (the section between the ascending and descending colons) and the bottom portions of both the left and right kidney.

6 0
2 years ago
Other questions:
  • The main organs of the excretory system are the _____.
    13·2 answers
  • Where can salt marshes be found?
    8·1 answer
  • Euglena is a unicellular organism with both chloroplasts and mitochondria. If scientists remove all of the chloroplasts from a E
    5·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The data in the graph are the result of a paramecium being placed in a hypertonic salt solution. mc026-1.jpg Based on the data i
    16·2 answers
  • What monomers are found in dna and rna
    6·2 answers
  • WILL BE MARKED BRAINLIEST
    11·2 answers
  • What are microplastics
    15·1 answer
  • Explain why disease alleles for cystic fibrosis (CF) are recessive to the normal alleles (CF+), yet the disease alleles responsi
    11·1 answer
  • Which statements are true about the element sulfur. (Select all that apply)
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!