Around 50000 rainforest species go extinct every year. true or false

2 answers:

34kurt4 years ago

8 0

The statement "Around 50000 rainforest species go extinct every year." is true. The principle essential reason for animal extinction in latest circumstances has been, with no sensible uncertainty, human request, either for creature assets specifically or for the regular assets constituting the creatures' living spaces.

Stella [2.4K]4 years ago

8 0

Answer:

true

Explanation:

You might be interested in

Behavioral ecology is based on which premise?

Sloan [31]

Answer:

option c)

Explanation:

the correct option is option c)

behavioral ecology is the study of behavior of interaction of the individual with the different community or society.

behavioral ecology study evolutionary behavior of species under ecological pressure.

if any organism has natural advantage in the ecosystem then natural selection favors them.

so, behavioral traits are subject to natural selection.

5 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Carrot slices placed in a 0.2 M salt solution for several hours become flaccid (limp). Carrot slices placed in fresh water for s

SpyIntel [72]

<h2>Carrot in 0.2M salt solution</h2>

Explanation:

Carrot cuts put in 0.2M salt answer for a few hours gets flabby (limp).
Carrot cuts set in freshwater for a few hours gets turgid (firm). From this, we can conclude that such as.

Freshwater is hypertonic and the salt arrangement is hypotonic to the cells of the carrot cuts.
Freshwater and salt arrangement are both hypotonic to the cells of the carrot cuts.
Freshwater is isotonic and the salt arrangement is hypertonic to the cells of the carrot cuts.
Freshwater is hypotonic and the salt arrangement is hypertonic to the cells of the carrot cuts.
Freshwater and the salt arrangement are both hypertonic to the cells of the carrot cuts.