1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DerKrebs [107]
3 years ago
8

Compare and contrast the traits of viruses and bacteria. Is a virus considered a living thing? Explain your answer in 3–5 senten

ces.
Biology
1 answer:
kkurt [141]3 years ago
3 0

Answer:

Bacteria are single-celled organisms that live in different environments, including cold and hot, and they can also live on or inside the human body.

Most types of bacteria are harmless, on the contrary, they help in the process of digesting food, attacking other microbes and fighting cancer cells, and less than 1% of bacteria are bacteria that cause diseases.

As for viruses, they are very small organisms, smaller than bacteria, consisting of DNA and a protein that coat them, and unlike bacteria, a virus does not reproduce without its presence in the cells of living organisms.

You might be interested in
Which nutrient has only a short term biogeochemical cycle
Alexus [3.1K]
The answer to your question is <span>nitrogen. 

*Brainiest answer plzzz</span>
4 0
3 years ago
Which of the following best describes an aspect of a membrane's molecular structure that causes it to be selectively permeable?
atroni [7]

Answer:

<u>d. Transport proteins within the membrane serve as a tunnel for molecules to enter the cell. </u>

<u />

Explanation:

Solutes are typically moved across the cell through either passive or active transport. The cells, surrounded by a bilipid layer or plasma membrane is amphiphlic- its polar, hydrophilic lipid heads face outwards, while their non-polar hydrophobic lipid tails face inwards towards each other.

While lipid-soluble molecules move across the layer easily, it is also difficult for charged and also large molecules to move across its surface, into the cell. Transmembrane channels, <u>embedded within the membrane</u>, help to maintain selective permeability as transport proteins, pores and gated channels. Simple diffusion happens as a method of passive transport in cells through plasma membranes.

The solutes travel through the plasma membrane in the process of diffusion from regions of high concentration to regions of low concentration; this occurs without the use of energy. <u>Molecules moving against their concentration require active transport mechanism to cross the membrane</u>.

3 0
3 years ago
How does treatment for a bacterial infection differ from treatment for a virus?
kari74 [83]
The answer is: you can treat bacterial infections, not viruses with antibiotics.

The use of antibiotics in viral infections is not effective and many organizations recommend the use of antibiotics only when there is a documented bacterial infection. The treatment of viral infections has been difficult for they are tiny and  replicate inside the cell. 
3 0
3 years ago
The urine in your bladder is unable to pass out of the bladder through its epithelial lining. which type of junction exists betw
fgiga [73]

the answer is.... tight junction

5 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • you are not required to wear a helmet while operating a motorcycle if you can show proof that you are covered by an insurances p
    11·2 answers
  • Hemophilia is a disease that causes uncontrollable bleeding. If a father has it, all of his daughters will be carriers of the di
    14·2 answers
  • Andrea works in an office where frequent outbreaks of colds and viruses occur. However,andrea stays healthy most of the time and
    5·2 answers
  • Is lactic acid fermentation used to make bread,beer,and wine?
    12·2 answers
  • He creationist and evolutionist are in agreement on all of the following items except:
    11·1 answer
  • Which type of cells allow to reproduce quickly and efficiently?​
    12·1 answer
  • What is 25678 decided be 1345
    13·1 answer
  • Please help!!! Question on picture :3
    15·2 answers
  • The business cycle illustrates the long-run fluctuations of ___.
    12·1 answer
  • Which one of the amino acids is capable of forming a disulfide linkage with itself?.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!