1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tom [10]
4 years ago
8

If a closed container contains a mouse as well as enough food, water, and oxygen for the mouse to live for three weeks, how much

will the container weigh 1 and 2 weeks later after the mouse has eaten, drunk, and exercised (respiration is CO2CO2 emission)?
Biology
1 answer:
ale4655 [162]4 years ago
5 0

Answer:

The life process may be defined as the different process that are important for the sustenance of life. The most important life process are nutrition, respiration, excretion and transportation.

If the mouse is placed in the closed sealed container then the weight will remain before and after the experiment of 1 or 2 week. This is because the life process metabolic reactions will use and conserve all the atoms involved in the life process. These atoms can exist in the liquid, solid and gas forms but present inside the container.

You might be interested in
What's the Deers habitat
d1i1m1o1n [39]
A deers habitat is in a forest?
5 0
3 years ago
Read 2 more answers
Please help need answers today.What is the best courses of action for the person shown below.
IrinaVladis [17]
Im pretty sure its b
6 0
3 years ago
System of flattened sacs that modify and package protein
mel-nik [20]
Its a membrane system
8 0
3 years ago
Read 2 more answers
Each pair of chromatids is attached at an area called the
lianna [129]
They are attatched at an area called the centromere
6 0
3 years ago
Read 2 more answers
In order to caluclate the specific activity of the isolated
Anastaziya [24]

Answer:

Explanation:

This is evident that all enzymes are proteins but not all proteins are enzymes. The specific activity can be define as the number of enzyme units per milliliters that is divided by the available concentration of the proteins typically in mg/ml. Thus the value of the specific activity can be measured in  units/mg.

In others words this can be said that how much enzymes units can be found in the 1 mg of the total protein. So in the total concentration of the proteins the estimation of the enzyme units is possible. Thus protein concentration is necessary for calculating the number of the enzyme units.

5 0
3 years ago
Other questions:
  • A blue tang is a tropical fish that is blue in color. What conclusion can be drawn regarding why the blue tang appears to be blu
    14·1 answer
  • How are meiosis and mitosis different? A. Mitosis produces haploid cells and meiosis produces diploid cells. B. Chromatids are f
    9·1 answer
  • Which of the following conditions would cause the salinity of ocean water to decrease? A. high rates of evaporation B. melting o
    14·1 answer
  • Describe how teens can learn positive behavior...HELP ASAP!!!!
    8·2 answers
  • In many states, the legal limit for all bacteria present in pasteurized milk is not to exceed 20,000 CFU/mL. You have been away
    9·1 answer
  • Which of these properties of a star best determines its life cycle?
    6·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Enzymes are: <br> A. fats. <br> B. sugars. <br> C. starches. <br> D. proteins
    8·1 answer
  • 2 points
    14·1 answer
  • What is the effort put by scientists and sailors to know about earth?​
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!