1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
777dan777 [17]
3 years ago
8

Methane is a major component of _____. A. coal B. wood C. uranium D. natural gas

Biology
2 answers:
jeka57 [31]3 years ago
8 0
I think the answer is D not positive tho
Natasha2012 [34]3 years ago
4 0
It'd be is Natural Gas. 
You might be interested in
- All bacteria contain peptidoglycan except...
sergeinik [125]
Your answer is D, Rhizobium
3 0
3 years ago
The total energy in a system is 675 J. The kinetic energy changes from 296 J to 432 J. Which statement best describes the potent
Leno4ka [110]

Answer:

it changes from 432 to 296

Explanation:

because energy have been lost meaning it will be -432+243

3 0
2 years ago
Read 2 more answers
Which situation would lead the client's family to suspect onset of dementia?
aksik [14]
The client has increasing experienced disorientaion to familiar surroundings
8 0
3 years ago
Which will form an ionic bond?
larisa86 [58]

The correct answer is B. Two oppositely-charged ions

Explanation:

In chemistry, ionic bonds only occur between ions oppositely charged, this means one of the ions has to be positively charged and the other has to be negatively charged. This is because there is a natural attraction between particles with different charges and this leads to the formation of chemical bonds. Also, this bond implies the transfer of electrons between ions. In this context, this type of bond can only occur with oppositely-charged ions. Moreover, particles with the same charges either negative, positive, or neutral do not experience attraction and cannot form ionic bonds.

5 0
3 years ago
Which molecule is active during the last step of DNA replication? A) Thymine B) Helicase enzyme C) nucleotidase B) DNA ligase
Rudik [331]
The answer to this question is b. Hope this helps!! :D
7 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Write one similarity and one difference between skeletal muscle and cardiac muscle.
    15·1 answer
  • Did earth experience normal or reverse polarity 1.5 million years ago
    13·1 answer
  • What is differential success in
    7·1 answer
  • For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to
    9·1 answer
  • What are four common types of drugs?​
    15·1 answer
  • PLEASE HELP ME! I need help so bad right now. I am super desperate and NEED to get this right. Please answer if you are sure. I
    9·1 answer
  • N/a pls help me. Asap
    12·1 answer
  • Can someone please help me on this all u have to do is search up on the internet and then put down 4 facts that are mentioned in
    12·1 answer
  • Which data would not affect maximum likelihood estimates of phylogenies when comparing different tree hypotheses?.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!