1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
love history [14]
2 years ago
12

What is the relationship between the Kuiper Belt and the status of Pluto today?

Biology
1 answer:
pentagon [3]2 years ago
5 0

The correct answer is B. The Kuiper Belt is home to a dwarf planet similar to Pluto

Explanation

The Kuiper Belt is the most remote area of the solar system, it is an elliptical region, which is more or less 149.5 million kilometers from the sun. Its name refers to the fact that it is a belt, so it could be associated with the appearance of the asteroid belt that is located between Mars and Jupiter. However, in the Kuiper Belt most objects are icy rather than rocky. In this region of the solar system you can find several dwarf planets such as Pluto, these planets are classified as such because their size is enough to be considered as or asteroids, but they cannot be considered planets either because they do not meet any requirement. According to the above, the correct answer is B. The Kuiper Belt is home to a dwarf planet similar to Pluto

You might be interested in
Creates clouds, snow, sleet, rain and hail
mote1985 [20]

Answer;

The Water Cycle

The water cycle creates clouds, snow, sleet, rain and hail. Precipitation, perspiration, etc.

Explanation;

-Water changes from a liquid to a gas form, called water vapor, through a process called evaporation. As liquid is heated by the sun's warmth, it changes into a gas form and rises in the atmosphere. In the air, water vapor cools and returns to a liquid form. This process is called condensation.

These water droplets cling together and form clouds. When the droplets become heavy enough, they fall to the ground as precipitation.


4 0
2 years ago
Read 2 more answers
High up in the Peruvian Andes, an anthropologist can expect to find adult residents who have Group of answer choices increased l
docker41 [41]

Several anatomical and physiological adaptations have been developed by people that live at high altitudes. Option A) increased lung capacities and higher basal metabolic rates.

<h3>What are human's adaptations to high altitudes?</h3>

Several studies have been done to study how humans adapt to living in high-altitude areas.

Populations living in areas of high altitudes, like Andean areas, have genetically adapted to breathe and take oxygen.

These individuals have suffered anatomical and physiological changes that enhance oxygen uptake and transport, making them more efficient.

Among these adaptations, their lungs got significantly larger in volume, while vessels, veins, and arteries volume, dilation, and constriction have adapted to get higher oxygen utilization and transference.

In these populations, gene sequences are involved in vascular control, metabolic hemostasis, and erythropoiesis.

The correct option is A)  increased lung capacities and higher basal metabolic rates.

You can learn more about adaptations to high altitude at

brainly.com/question/24097855

brainly.com/question/17093036

#SPJ1  

7 0
2 years ago
18. Identify the term that correctly identifies the sentence.
Andreas93 [3]

Answer:

It is a compound sentence.

Explanation:

Compound sentence contains two independent clauses.

5 0
3 years ago
What is filler metal, and why might it be needed to produce a joint?
vodomira [7]
Filler Metal is a type of metal used in the fusion welding union, and it is necessary to produce a joint because it serves to collaborate in the opposition, to a greater or lesser degree, against the forces applied to it, without suffering deformation or breakage.
3 0
3 years ago
Progressive changes in fossils of different ages provides one of the strongest lines of evidence for
kykrilka [37]
Are there any options you can provide?
3 0
3 years ago
Other questions:
  • Peyer's patches are mucosa-associated lymph tissue located in the
    9·2 answers
  • Submerging a red blood cell in distilled water will result in
    14·2 answers
  • A boy hits a 0.05kg golf ball, giving it a velocity of 75 m/s. what is the momentum of the golf ball?
    7·1 answer
  • (iii) Parts of _________ help us to maintain body balance
    8·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • The process by which a bacteria cell divides into two identical cells is called:
    11·2 answers
  • Which of the following does not result in a cell with a new genetic
    14·2 answers
  • In which of the following spheres of Earth is most carbon stored long-term?
    8·1 answer
  • Suppose the DNA sequence GCT ATA TCG was changed to GCTАТТ TCG. How would the products of translation, the amino acids, be affec
    10·2 answers
  • What type of cells does a mutation affect that will have no effect on a possible offspring?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!