1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Brut [27]
3 years ago
11

The physical force exerted by a fluid on a structure is ____________ . The main pressure is the ____________ hydrostatic pressur

e, which pushes materials ____________ the capillary. The other main force regulating filtration and reabsorption is ____________ , which refers to the "pull" of water into an area by osmosis due to the ____________ relative concentration of solutes.
Biology
1 answer:
Leto [7]3 years ago
4 0

The physical force exerted by a fluid on a structure is HYDROSTATIC PRESSURE . The main pressure is the BLOOD hydrostatic pressure, which pushes materials OUT OF the capillary. The other main force regulating filtration and reabsorption is OSMOTIC PRESSURE , which refers to the "pull" of water into an area by osmosis due to the HIGHER relative concentration of solutes.

You might be interested in
Gray seed color in peas is dominant to white. Assume that Mendel conducted a series of experiments where plants with gray seeds
bazaltina [42]

Answer:

(a) Gg × Gg; (b) genotypic = 1:2:1, phenotypic = 3:1

Explanation:

a) A cross between two gray seeded plants produces progeny with gray and white seeds in 3:1 ratio (302:98=3:1). This means that the parent plants are heterozygous and each has at least one recessive allele. If the allele "G" is responsible for gray seed and the allele "g" imparts white color to the seeds, the genotype of the heterozygous parents would be "Gg".  

b) A cross between two heterozygous gray seeded parents would produce progeny in following ratio:

Genotype ratio= 1 GG: 2 Gg: 1 gg

Phenotype ratio= 3 Gray: 1 white

4 0
3 years ago
Why would diabetes make a person feel tired? Be specific in your response.
kati45 [8]

Fatigue can have causes that aren't due to underlying disease. Examples include lack of sleep, heavy exertion, jetlag, a large meal, or aging.
6 0
3 years ago
Read 2 more answers
List the qualities of the atmosphere that make it safe and comfortable for people to live on this planet (use at least 5 sentenc
lilavasa [31]
Chlorofluorocarbons (CFCs) chemicals contain carbon, chlorine and fluorine and is t so expensive at the same time it’s not flammable, the reason why it is mainly used in business such as refrigerators and plastics. However, these chemicals destroys our stratosphere, the second layer of the Earth’s atmosphere and protects us by blocking the ultraviolet radiation (UV Light). This type of radiation can seep through organisms skins and can leave destructive effects on DNA molecules which will also cause skin cancer. Chlorofluorocarbons (CFCs) chemicals contain carbon, chlorine and fluorine and is t so expensive at the same time it’s not flammable, the reason why it is mainly used in business such as refrigerators and plastics. However, these chemicals destroys our stratosphere, the second layer of the Earth’s atmosphere and protects us by blocking the ultraviolet radiation (UV Light). This type of radiation can seep through organisms skins and can leave destructive effects on DNA molecules which will also cause skin cancer. <span> </span>
8 0
3 years ago
Which is an ion found in a glass of water?<br> A. 02<br> O B. H+<br> O C. Nt<br> O D.O-
laiz [17]
D is the ion found in water
8 0
3 years ago
How do apples get there energy
gavmur [86]

Answer:

Here's what happens when you eat an apple: The carbohydrate breaks down into a sugar called glucose and enters your bloodstream  

Explanation:

i got some help from google

4 0
3 years ago
Other questions:
  • Match the activities to the respective category.
    8·1 answer
  • Does Darwin’s theory of Nature selection explain how evolution occurs ?
    6·1 answer
  • I need help with this Punnett square Practice
    9·1 answer
  • Which objective lens is the longest?
    15·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • 1. Explain the change in erythrocyte count in the case of anemia
    6·1 answer
  • Please help <br> With this !!
    8·1 answer
  • WILL GIVE BRANLIEST !
    8·2 answers
  • Which among these is a biotic factor?
    15·2 answers
  • What are blood transfusions NOT used for?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!