1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitriy789 [7]
3 years ago
10

Give an example of climate data.

Biology
1 answer:
Mars2501 [29]3 years ago
3 0

Answer:

An example of a temperature data analysis that shows high, low, and average temperatures throughout a year. ... These types of information include record temperatures, record precipitation and snowfall, climate extremes statistics, and other derived climate products.

https://www.ncdc.noaa.gov/climate-information/statistical-weather-and-climate-information

Explanation:

You might be interested in
Explain the energy transformation process needed to create an electromagnet .
Lina20 [59]
The energy transformation so far, chemical energy transforms or changes into electrical energy. ... Therefore, chemical energy transformed into electrical energy in the wire, then transformed into electromagnetic energy in the nail.
6 0
3 years ago
The Moon's repeated pattern of movement and changes in appearance is known as the revolution .It is due to the Moon?
wolverine [178]

Answer:

No, the patterns are made by the light of the sun that reflects on the moon. The darker part of the moon is caused by the shadow of the earth.

4 0
2 years ago
What is sensory neurone?
leva [86]
Sensory neurons are types of brain cells that convert the stimuli coming from the senses (hearing, touch, smell, taste, and sight) into information that would allow the brain to interpret it as a sensation. For example, they convert the messages from the optical nerve if the object is of a light color or not.
3 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
How do living things use each type of nucleic acid
Anton [14]
Genetic information.The main job of DNA is to carry the code for making protein.A gene is a stretch of DNA that can be read by proteins called ribosomes, and copied I to type of nucleic acid called massenger RNA.
7 0
3 years ago
Other questions:
  • Tropical rainforests are located in _______. a. Europe b. Southeast Asia c. North America d. none of the above
    11·2 answers
  • HELP Which situation would not encourage competition? Select one:
    11·2 answers
  • ​which portion of the lymphatic system is the major site of antibody production?
    6·1 answer
  • 13) Which of the following is NOT one of the 5 major climate zones?
    14·2 answers
  • All cells in an embryo have the same DNA. However, the embryonic cells form organs, such as the brain and the kidneys, which hav
    6·1 answer
  • What is one specific form of simple diffusion? PLEASE HELP ME!
    13·1 answer
  • Scientists study the bones of two cat species to understand their evolutionary lineage. Which field of study will help scientist
    15·2 answers
  • Process of biological change by which descendants come to differ from their ancestors
    7·1 answer
  • State the importance of calcium and zinc in our body​
    13·1 answer
  • Name two substances that will be attacked by a corrosive acid
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!