1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
forsale [732]
3 years ago
8

Based on the arrows, what does the image represent?

Biology
1 answer:
Karolina [17]3 years ago
4 0

Answer:

I think the answer is B i might be mistaken though c:

Explanation:

You might be interested in
What is the difference between inorganic and organic
sergey [27]

That one of then is not organic and the other is organic and remember -in stands for not

6 0
3 years ago
What happens when a carnivorous plant grows in soil rich in nutrients?
mash [69]

Answer:

that carnivorous plants will invest more energy in nutrient uptake from the soil and less energy in prey capture whenever possible.

7 0
2 years ago
Read 2 more answers
Which statement best explains how enzymes speed up chemical reactions?
Leni [432]
The answer would be D.

Enzymes activity increases as the temperature increase so, therefore the answer would be D.
but to be fair they all would work.
7 0
2 years ago
What are the physical properties of he wax burning in a candle?
Naddik [55]

Candle wax is essentially the fuel that allows a candle to burn over long periods of time. Wax is composed of long chains of carbon and hydrogen that form waxy solids at room temperature and can be molded into any shape, the heat from the flame melts the candle wax into liquid vapor as well as liquid.

8 0
3 years ago
When food falls on the ground in a Malian house, who eats it?
dlinn [17]

Answer:

The Rats.

Explanation:

I think it would be the rats because its a common pest and who has chickens around their house?

3 0
3 years ago
Other questions:
  • Giraffes evolved over many generations to have long necks. Giraffes that had longer necks were more likely to survive than giraf
    5·2 answers
  • The stage of cell signaling in which a chemical signal is ""detected"" when the signaling molecule binds to a receptor protein l
    14·1 answer
  • PLEASE HELP!!!!! 19pts!
    7·1 answer
  • Pls answer this you guy are amazing
    12·1 answer
  • For organisms to be classified as the same species, they must be able to breed with each other and produce _____ offspring.
    7·2 answers
  • How are the functions of a carbohydrate and a lipid similar? Both lower the activation energy of reactions. Both dissolve nutrie
    7·1 answer
  • A young man was visiting his grandmother at her assisted living facility. When he got to her room at 8:30 am, he
    10·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • HURRY PLZZ
    14·1 answer
  • What is the process where water enters
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!