1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spin [16.1K]
4 years ago
10

A farmer is breeding Andalusian chickens. He notices that when he mates a black chicken with a white chicken, the offspring are

spotted black and white and look blue in color.
What is the name of this inheritance pattern?

A)

codominance



B)

segregation



C)

multiple alleles



D)

incomplete dominance


What are the chances that a cross between a black chicken and white chicken will result in blue offspring?

What are the chances that a cross between a black chicken and white chicken will result in blue offspring?
Biology
1 answer:
borishaifa [10]4 years ago
8 0
D- neither attribute is taking dominance so it is incomplete
You might be interested in
Based on these data alone, identify the most appropriate hypothesis that explains the effect of peptides 1 and 2 on the quorum-s
DochEvi [55]
Data shows results of an experiment which was added to each peptide to culture the TRAP. Mutants of S. aureus and culture of the Agr. mutant of s. aureus.
Peptide 1 and three blocks Agr pathway
Peptide 2 blocks TRAP pathway
This is because the mutants are already blocked for one of the pathways.
Therefore it gives way to determine which pathway each peptide act on.
3 0
3 years ago
Which of the following does not describe a function of aggressive animal behavior?
nalin [4]

Answer:

C

Explanation:

Aggressive behaviour is a act of violence not without it

5 0
4 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
Solar power and wind power are similar because
Neporo4naja [7]
They are both renewable resources 
5 0
3 years ago
How does energy from the sun travel to Earth? Choose the two correct answers.
Phantasy [73]

Answer:

the answers are a and d

Explanation:

Light, that is the main reason that we are able to see during the day because of the light

Heat if the sun is shining bright and youre outside you can feel the heat

have a great day :D

5 0
3 years ago
Other questions:
  • Which of the following would a specialized tissue cell NOT differentiate into?
    7·1 answer
  • What two forces shape an organism’s characteristics?
    10·2 answers
  • "E. coli is an intestinal organism, and Staphylococcus epidermidis resides on the skin. What do you hypothesize will occur when
    12·1 answer
  • a point mutation occurs in a sex cell of an adult rabbit. The gene affected by the mutation is responsible for proteins that bui
    7·2 answers
  • What was the main purpose of the declaration of independence
    11·1 answer
  • There is reciprocal regulation of glycolytic and gluconeogenic reactions interconverting fructose-6-phosphate and fructose-1,6-b
    12·1 answer
  • Which TWO events happen in the rock cycle
    5·2 answers
  • Eukaryotic cells are somatic non-sex cells true or false
    14·1 answer
  • Compare and contrast the structures of DNA and RNA
    14·1 answer
  • members of the gram-negative genera aquifex and hydrogenobacter are hydrogen-oxidizing bacteria. an example of their metabolism
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!