1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivolga24 [154]
3 years ago
12

Part One: Wave Facts 1. What type of waves can only travel through a medium?

Biology
1 answer:
Likurg_2 [28]3 years ago
4 0

Answer:

Mechanical waves

Explanation:

Mechanical waves are produced from the oscillation of matter. Examples of mechanical waves are sound waves, P & S waves of earthquakes, and etcetera. This means they require a medium to transfer energy. They cannot transfer energy in a vacuum, unlike electromagnetic waves.

You might be interested in
How does solid rock become soil
kipiarov [429]

rocks can become soil in multiple different ways one could be primary succession which means some algae or moss grows onto rocks with out soil then they slowly gain moisture which attracts some other plants like flowers which then breaks down the rock into smaller things then grasses come in and turns it into soil.

4 0
3 years ago
Composting helps the environment by reducing the amount of solid waste that is deposed in landfills. What is an example of a sol
ratelena [41]
I believe the answer would be D) kitchen scraps and grass clippings
3 0
3 years ago
Read 2 more answers
When the expression of one allele is masked by the presence of another it is said to be what??
Bezzdna [24]
The allele that is masked is recessive. The one which masks it is dominant.
7 0
3 years ago
___ are categorized by structure and function; ___ are categorized by their support roles.
OlgaM077 [116]

Answer:

Neurons; glia

Explanation: i took the test!

8 0
2 years ago
Arrange the inner layers of the Sun in order starting with the innermost layer.
andrew11 [14]

Answer:

B, A, C, D

hOPE THIS HELPS:)

4 0
3 years ago
Other questions:
  • When a female mammal's ova are ready to be fertilized, we say she is in estrus or "in heat."
    14·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • The treatment of TB involves a _____.
    11·2 answers
  • How can scientists communicate their findings
    5·2 answers
  • What does Tt mean to geneticists
    15·2 answers
  • URGENT!!!!!!!!-What is the carrying capacity of the graph?<br> OPTIONS:<br> 4<br> 6<br> 13<br> 20
    11·1 answer
  • Anyone ?? This is a timed this
    5·2 answers
  • Name the 6 roles of proteins in the body.
    7·1 answer
  • Organ systems work together to meet the needs of the human body. How is the skeletal system related to the nervous system?
    5·1 answer
  • Nitrogen dioxide is a gas that can be generated by emissions from vehicles and factories. It can also be generated by natural so
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!