1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vanyuwa [196]
3 years ago
6

One of the major categories of receptors in the plasma membrane reacts by forming dimers,adding phosphate groups, and then activ

ating relay proteins. Which type does this?
A) G protein-coupled receptors B) ligand-gated ion channels C) steroid receptors D) receptor tyrosine kinases
Biology
1 answer:
Vilka [71]3 years ago
5 0

Answer:

D) receptor tyrosine kinases

Explanation:

Protein kinase receptors are simply saying receptors with associated kinases (usually tyrosine kinases).

Protein kinases are enzymes that have the ability to modulate other enzymes (or some other proteins) by adding the phosphate group. This is known as phosphorilation process. As a result of structural change, protein can change its activity (phosphorilation usually increase the activity).

Such receptors are involved in a many processes within an organism that are important for the cellular growth, differentiation, metabolism

You might be interested in
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
UNIT TEST!! Help!! :C
valentinak56 [21]

Answer:

for number one i got ☐ It involves the modification of DNA

☐ It attempts to replace a mutated gene with normal DNA.

☐ It does not always cure patients who use it.

FOR NUMBER TWO I GOT:

D.)genotype: Rr

phenotype: black eyes

plz mark brainliest!!!

5 0
3 years ago
EXTRA POINTS FOR THIS
sergeinik [125]

Answer:

No

Explanation:

Matter can not be created or destroyed it can only change form. For example two Oxygen atoms can react with one hydrogen atom to form water but the oxygen and hydrogen is not destroyed,

3 0
3 years ago
All fungi are __________.
Fudgin [204]
Multicellular
hope this helps
3 0
3 years ago
Read 2 more answers
The charge nurse is preparing for the arrival of clients to the emergency department (ed) after a mass casualty incident (mci).
saveliy_v [14]
To determine how many patient can be safely accepted from each level of severity.
5 0
3 years ago
Read 2 more answers
Other questions:
  • Many grapes varieties are naturally, more or less, cold hardy and have been found to have definitive winter temperature threshol
    10·1 answer
  • Phloem sap can flow
    15·2 answers
  • One of the best ways to determine the adequacy of peripheral circulation is to check the pedal pulse. To check the pedal pulse,
    13·2 answers
  • What is a scientist called who observes animals in order to explain their behavior?
    10·2 answers
  • 1 point
    8·1 answer
  • What is an underlying notion that supports the 12-step program of alcoholics anonymous?
    7·1 answer
  • Dysfunctional breathing results in an increase in the activity level of which of the following secondary respiratory muscles
    9·1 answer
  • Cheetahs catch prey by being very fast. Same cheetahs are fast than others and catch more pray. Slower cheetahs do not get enoug
    10·1 answer
  • How does the process of hydration cause chemical weathering?
    13·1 answer
  • Horses went extinct in North America and did not return until they were ferried in boats by European settlers (no land mammal ca
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!