1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NNADVOKAT [17]
3 years ago
5

Indicate the phenotypic ratio of crossing the offspring of the agouti and chinchilla.

Biology
1 answer:
devlian [24]3 years ago
4 0

Answer:

Option A is correct.

Explanation:

Phenotype ratio is the number of one phenotype compared to another phenotype.( physical characteristics)

C/cch * C/c

You might be interested in
What three things does something need to have in order to be considered living?
Semmy [17]

Answer:

air water and food

Explanation:

all living things need air, water, and food.

5 0
3 years ago
What applies to the collision therory
andriy [413]
The collision theory<span> is based on the assumption that for a reaction to occur it is necessary for the reacting species atoms or molecules to come together or </span>collide<span> with one another.\</span>
6 0
3 years ago
What would happen to an organism if mitosis did not occur? Check all that apply.
almond37 [142]
4 the organism would not produce new cell idk if im right
4 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
The portion of a muzzleloader rifle that fits against your shoulder is the
asambeis [7]

The portion of a muzzle-loader rifle that fits against your shoulder is the - BUTT.

A muzzle-loader is a firearm in which the projectile and usually the propellant charge is loaded from the muzzle of the gun. This is distinct from the more popular modern designs of breech-loading firearms. That portion of a muzzle-loader rifle that fits against ones shoulder is called the butt.

6 0
3 years ago
Other questions:
  • Chemical reactions are result of an atom attempting
    11·2 answers
  • What is One way the endocrine system helps maintain homeostasis
    13·1 answer
  • Why are there several structurally different pigments in the reaction centers of the photosystems?
    7·1 answer
  • Polydactyly is a dominant trait. what symbol on a pedigree chart would represent a male who has polydactyly
    11·1 answer
  • Based on the illustration, what happens to most of the mass gained by the plant cell through photosynthesis? A) The mass is retu
    12·2 answers
  • Which condition need to be in balance for cells to function
    14·1 answer
  • Brainliest please
    7·1 answer
  • Ill give brainliest... its currently 12:20 am and im too tired to re answer this "correctly". Please help a human out
    6·1 answer
  • _____ is on the shoulders of the police and investigation team.
    7·1 answer
  • Directions: List 5 examples for each type of change to matter.
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!