1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fed [463]
3 years ago
5

What components of blood can be examined?

Biology
1 answer:
Phoenix [80]3 years ago
8 0

Answer:

Explanation:plasma or white blood cells

You might be interested in
Question 8 of 35
lapo4ka [179]

Answer:

C

Explanation:

The claims of astrology are based on imagination rather than empirical evidence

3 0
3 years ago
Quais são os 3 tipos de vasos encontrados no corpo?
TiliK225 [7]
Arterias, venas y capilares.
5 0
3 years ago
Read 2 more answers
What is the purpose of an antibody? Group of answer choices to stick to an antigen, alerting your body of the presence of a fore
Alexandra [31]

Answer: Antibodies are proteins that are found in the body on the surface of red blood cells and in the blood plasma ,they are very sensitive to foreign bodies and bad viruses and bacteria,when they notice the presence of anything that poses harm or a threat to the body system,they track it down and fight/destroy it.

Antibodies also play crucial role in hemostasis(stoppage of bleeding) in the sense that when the body is wounded or when someone gets a cut antibodies that are found in the plasma and some substances found in the platelets are released to play a role in sending signal to the blood clotting factors in the blood to be released to arrest the bleeding and prevent the person from bleeding out their entire blood.

5 0
3 years ago
NADH and FADF2 are the blank forms of NAD and FAD
Nana76 [90]

NADH and FADF2 are the reduced forms of the nicotinamide adenine dinucleotide (NAD) and flavin adenine dinucleotide (FAD) coenzymes.

<h3>What is nicotinamnde adenine dinucleotide?</h3>

The nicotinamnde adenine dinucleotide (NAD) is a coenzyme used in the transport electron chain of the cellular respiration.

The movement of electrons is coupled to a proton gradient in order to generate ATP, the energy coin of the cell.

In conclusion,  NADH and FADF2 are the reduced forms of the nicotinamide adenine dinucleotide (NAD) and flavin adenine dinucleotide (FAD) coenzymes.

Learn more about NADH here:

brainly.com/question/11538586

#SPJ1

8 0
1 year ago
Prevention of water loss is a category of necessary function for life that would best fit in the category of
Effectus [21]

Answer:

Explanation:

a

7 0
1 year ago
Other questions:
  • What is haldane oparin theory?
    10·1 answer
  • The law states that rock layers closest to the surface are the youngest rock is the
    7·1 answer
  • Jordan wants to conduct an experiment to see if plant food makes a difference in how well plants grow. He gets 10 pots and plant
    5·2 answers
  • Hot water from a power plant is flowing into a river and killing the aquatic life. What type of pollution is causing this situat
    12·2 answers
  • Which of thse is an agent of wedging?
    7·1 answer
  • What is the approximate size of a nucleus in a elodea cell?
    9·1 answer
  • With your fragment now in an expression plasmid, you will need to check to ensure that the fragment is in the correct reading fr
    7·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What is Thalassemia???​
    12·2 answers
  • What do the triangles represent on a topographic map. A mountain peak. B location of a ravine. C steepness of a slope. D distanc
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!