1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bess [88]
3 years ago
15

In humans, three weeks after conception a structure known as the _____ forms that will continue to develop into the central nerv

ous system.
Biology
1 answer:
Ann [662]3 years ago
8 0

The answer is a neural tube.

You might be interested in
Please help me in science!
lidiya [134]
D. As salt water in the oceans.
7 0
3 years ago
A swim team thinks that the swimsuits and swim caps they use may affect the team's performance. The swim team decides to test if
densk [106]

Answer:

A

Explanation:

They need a control group

3 0
1 year ago
Read 2 more answers
The nurse receives a report from labor and delivery on an infant and mother couplet. which reported apgar score will the nurse p
fgiga [73]

No.  The mother needs full support from the nurse during the transition period but  APGAR test (<span>Appearance, Pulse, Grimace, Activity, and Respiration) is done only twice to a baby. The first-  one minute after birth and the second, 5 minutes after.  </span>

7 0
3 years ago
Compare the two new strand of dna. are they the same or different?
BabaBlast [244]
Different, because the old strands were not the same. The nucleotides of each strand of DNA are bonded together in a very specific way - it is called complementarity.
For instance, one strand has a following sequence: ATTGACC . The other strand (or the new strand synthesised based on that strand) has complementary sequence: TAACTGG
7 0
3 years ago
The end of of a muscle that is attached to the immovable bone is called the
Ray Of Light [21]
Answer: origin.

The end of a muscle that is attached to the immovable  bone is called the origin.

In some parts I have found that they refer origin of a muscle as the bone, while in other parts I have found that they refer tha origin is part of the muscle.

Anyway, the question is refering to this part: the origin of a muscle, which is a the end of a muscle that is attached an immovable or less movable bone.
8 0
3 years ago
Other questions:
  • How does the location of a biome impact the climate?
    5·1 answer
  • What type of relationship MOST LIKELY exists between the birds and the elephant? A) mutualism B) parasitism C) predation D) repr
    14·1 answer
  • Which has the most control of traits and inherent
    5·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which was an idea used to dispute the theory of plate tectonics?
    14·2 answers
  • Which of these biomolecules increase membrane fluidity and help prevent the cell membrane
    11·1 answer
  • Answer this......<br>please.........<br>..<br><br><br><br>​
    8·2 answers
  • Can someone please help me both of them
    14·1 answer
  • Which two types of immunity requires white blood cellss
    13·2 answers
  • What direction does rna polymerase synthesize rna?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!