1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lana66690 [7]
4 years ago
15

What is the main fuel source for the work of the cell?

Biology
1 answer:
Crazy boy [7]4 years ago
5 0

Adenosine triphosphate is the main fuel source for the work of the cell. Hope I helped



You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Which organelle does the krebs cycle take place?
OleMash [197]
In the mitochondria of the cell
8 0
3 years ago
The hypothesis would not have been supported
WARRIOR [948]

Answer: it’s B

Explanation:

6 0
3 years ago
Read 2 more answers
Differentiate between plant of sugarcane and plantain
tatyana61 [14]

Answer:

hlahhbsll

Explanation:

sorryy need points

7 0
3 years ago
How many letters in a codon?<br> Select one:<br> O 5<br> o 6<br> O 3<br> o 4
lesya692 [45]
3 letters in codon :)
6 0
3 years ago
Other questions:
  • Enzyme activity within metabolic pathways is regulated by _____.
    10·2 answers
  • 13. a liver cell and a nerve cell in you body has the same dna. why does the liver cell have different structures and functions
    7·1 answer
  • Plants in the phylum bryophyta grow in areas that are _____.
    9·2 answers
  • When are scientific claims accepted? And when are they questioned and/or rejected?
    15·1 answer
  • Why is sunlight written above the arrow in the equation,rather than on either side of it?​
    7·1 answer
  • Whales, sharks, and penguins, all in different classes of animals, have streamlined bodies with fins or flippers for efficient m
    9·1 answer
  • Please help ASAP ❤️❤️
    14·1 answer
  • The nursing instructor is teaching the student about occurrence reports. Which statement by the student indicates an understandi
    7·2 answers
  • Earthworms, bacteria and fungi are all examples of
    9·1 answer
  • 1. The cells in our bodies are surrounded by these types of solutions.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!