1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kazeer [188]
3 years ago
9

Earthworms, bacteria and fungi are all examples of

Biology
1 answer:
fiasKO [112]3 years ago
7 0

Answer:

Decomposers

Explanation:

You might be interested in
The following are the steps for B-cell activation. The steps are in an incorrect order.
Nataly_w [17]

Answer:

4. B cells become activated by interacting with helper T cells.  

1. B cells display antigens in MHC class II receptors on the cell surface.  

2. Antibodies released by plasma cells bind to the antigen so they will be destroyed by other cells of the immune system.

3.B cells rearrange their DNA to create a unique B-cell receptor.  

5. B cells undergo clonal expansion.

6. B cells digest antigens that bind to the antibodies on their surface.

Explanation:

B-cells get activated by interacting with helper T cells when they bind to the antigen to receptors i.e (MHC class II receptors on the cell surface) on the surface of the cell. Series of activities such as release by plasma cells which cause rearrangement of B cells causes the cell to divide and proliferate. The process through which daughter cells arise from a parent cell called clonal expansion.

4 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Which statement best describes the motion of the toy vehicle during the first 30 seconds of the
pashok25 [27]

Answer:

kinetic energy

Explanation:

if something is moving that means its kinetic if its still its potential

6 0
2 years ago
___________ is a drug that is regularly used in veterinary medicine.
Blababa [14]
Ketamine is the drug regularly used in <span>veterinary medicine. </span>
7 0
3 years ago
Which dark solar feature is shown in the picture above?
AleksAgata [21]
I think its sunspot because its on the sun and it looks like a spot
3 0
3 years ago
Read 2 more answers
Other questions:
  • The pedigree chart could represent all of the following disorders EXCEPT A) hemophilia B) sickle-cell disease C) red-green color
    11·2 answers
  • Explain the basic parts of a major theme molecular biology: the pathway of DNA to RNA to Proteins. Inculed a grneral idea of wha
    13·1 answer
  • Vaccination is a process of injecting a dead or weekened form of a germ into the body. How does this help strengthen the immune
    7·1 answer
  • How does a plant use the sugar molecules produced by photosynthesis that are not used for cellular respiration
    12·2 answers
  • PLZ HELP Will also give brainliest 1.What is DNA? Why is it important to every living thing?
    7·1 answer
  • Clouds form when water vapor in the atmosphere cools to _______.
    15·2 answers
  • Why does genetic engineering raise ethical concerns​
    10·1 answer
  • What is a inorganic compound in a living cell
    15·1 answer
  • Based on the information in the table, what is the most likely explanation for a decrease in the total waste produced in 2008? E
    10·1 answer
  • Adaptations of a muscle cell to its functions​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!