1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
motikmotik
3 years ago
12

Why are they endangered tigers

Biology
1 answer:
Jet001 [13]3 years ago
8 0

Answer:

because tigers are getting killed for their fur I think

I hope this helps

is that even one of the answers-

I'm sorry if I did not answer it correctly

You might be interested in
Does a function of skin give off carbon dioxide?
stepladder [879]
No that's the respiratory system
4 0
4 years ago
Which of these is not commonly regulated in county ordinances?
adell [148]
Welfare is not commonly regulated in county ordinances <span />
5 0
3 years ago
Chemical buffer systems act rapidly against shifts in ph, whereas physiological buffer systems function more slowly.
DerKrebs [107]
I think its true but i could be wrong 

3 0
3 years ago
Hi have you guys been?
Eva8 [605]

Answer:

good

Explanation:

i had a great day :)

5 0
4 years ago
Read 2 more answers
A biologist wants specifically to examine the surfaces of different types of cells in kidney tubules of small mammals. The cells
lora16 [44]

Answer:

Scanning electro microscopy

Explanation:

"A scanning electron microscope (SEM) scans a focused electron beam over a surface to create an image. The electrons in the beam interact with the sample, producing various signals that can be used to obtain information about the surface topography and composition"

Reference: Nanoscience Instruments. “Scanning Electron Microscopy.” Nanoscience Instruments, 2019

8 0
3 years ago
Other questions:
  • Which characteristic is shared by all four cells
    5·1 answer
  • Find the total number of red blood cells, white blood cells, and platelets in 1mm3 of blood. calculate what percentage of the to
    10·1 answer
  • Which of the following is not a goal of science?
    5·2 answers
  • What causes the density of basalt to be greater than the density of granite? Select all that apply. Granite cools much faster th
    13·1 answer
  • In the population, 8% of males have had a kidney stone. suppose a medical researcher randomly selects two males from a large pop
    11·1 answer
  • Organ, blood, and bone marrow transplants are lifesaving procedures that come from what sources?
    13·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • Zooplankton get their energy from<br> phytoplankton<br> grasses<br> photosynthesis<br> small fish
    15·1 answer
  • Which of the following are not examples of circular motion? Check all that<br> Apply
    11·2 answers
  • What happens to DNA after RNA polymerase has synthesized a mRNA molecule?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!