1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bagirrra123 [75]
3 years ago
9

What type of gametes does a spider plant have?

Biology
1 answer:
MAVERICK [17]3 years ago
3 0
Gametes and female gametes joining, during fertilization, to produce a zygote and then an embryo. Most plants produce both male and female gametes, while some produce one or the other. Pollen contains the male gametes and is found on the stamen. Ovules contain the female gametes and are found in the pistil.
You might be interested in
Red-green color blindness is a human x-linked recessive disorder. the normal allele, xb, is dominant to the mutant allele, xb. j
bazaltina [42]
Very interesting problem!

On first reading, it sounded impossible.  Tom has normal vision, and there are no male carriers for x-linked recessive disorders.  So the daughter can at best (or worst) be carrier of the disorder.

We are told that the daughter has the disorder, but the daughter can only be a carrier with genotype XBXb.

We are also told that Turner Syndrome, which is a disorder related to the x-chromosome.  Half of those affected have one of the x-chromosomes missing (monosomy), and some others have some cells with missing or deformed x-chromosomes (mosaicism).  Under these circumstances where the normal chromosome is missing, the X-linked recessive Xb allele will be expressed, hence even a carrier can express the red-green colour-blindness.

From the pedigree chart, we can deduce that the colour-blindness must be inherited from Jill, the mother.  Tom with normal vision cannot be a carrier because X-linked recessive disorders do not have male carriers.

The daughter's colour-blindness is derived from two sources,
1. inherited Xb allele from mother Jill
2. Turner syndrome that allowed the single allele to express colour-blindness.



5 0
3 years ago
Which of the following are electron carriers in many important cellular processes?
GalinKa [24]

Answer:

1. B. NADH

2. B. hydrolysis of ATP.

3. C. ATP is produced from protein.

4. Option C.

5. Option C. Oxygen

6. Option D. Glucose.

7. Carbondioxide.

8. Metabolism.

9. Electron carriers.

10. Electrons.

Explanation:

Cellular respiration is a series of metabolic processes that break down sugars or food to produce energy. ATP is the cellular energy produced during cellular respiration. Cellular respiration requires oxygen which is also called aerobic respiration. There are stages of cellular respiration and they include; glycolysis, pyruvate oxidation, Krebs cycle or citric acid and oxidative phosphorylation. During cellular respiration, glucose is broken down into carbondioxide and water. Along the way, ATP is produced from the processes that transform glucose.

Explanation:

4 0
3 years ago
Estimate the widths of three molecules, napthalene, fluorescein, and texas red
Anastaziya [24]
Eight inches four inches and eighteen inches
3 0
4 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
HELPPP
MAVERICK [17]
It should be D.
hope this helps
7 0
3 years ago
Other questions:
  • 1. The Devonian period is considered the Age of Fishes. Would you expect
    9·1 answer
  • What are the most important processes in the cycling of oxygen in and out of the atmosphere
    6·1 answer
  • What elements are the cell wall made of
    13·2 answers
  • The disease that is most likely to increase in incidence because of the thinning of the ozone layer is
    6·1 answer
  • Plsss helppppp ASAP <br> Will give extra 20 points
    5·1 answer
  • The milk sugar,lactose,is made up of glucose and galactose.Whag type of carbohydrates is lactose
    14·1 answer
  • Which of the following statements about forest fires and the atmosphere is true?
    12·1 answer
  • What does crossing over have to do with traits inherited by offspring in relation to the traits that their parents have?
    14·1 answer
  • Need help ASAP! THANK YOU, DO QUESTION 10
    9·1 answer
  • One of the four fundamental interactions in nature is? Electromagnetism Gravity Strong interaction All of the above
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!