1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kiruha [24]
3 years ago
13

Cytochrome c is an enzyme located in the mitochondria of eukaryotic cells. The number of differences in the amino acid sequences

of Cytochrome c from
different species area compared to human Cytochrome c in the data table below.
Differences in Amino
Acid Sequences
Organism Number of Differences in
Cytochromec
Compared to Humans
tuna
21
mold
48
moth
31
dog
11
horse
12
chicken
13
monkey
How can this sequencing be used to determine relationships for common ancestry in different species?
A- The fewer the differences, the closer the relationship and more likely the organisms share common ancestry
B- The fewer the differences, the further apart the relationship and the less likely the organisms share common ancestry
C- The higher the differences the closer the relationship and more likely the organisms share common ancestry
D- The higher the differences the further apart the relationship and the more likely the organisms share common ancestry
Biology
1 answer:
tatuchka [14]3 years ago
3 0

Answer:c is the answer

You might be interested in
What is meant by the term epistasis? Distinguish between epistasis and dominance. Do not use examples in answering this question
Sunny_sXe [5.5K]

Answer:

Epistasis is a phenomenon in Genetics in which mutations on one gene locus are dependent on the mutations on some other genes locus. In other words, the expression of a phenotype of one gene is dependent on the presence or absence of mutations on other gene.

Dominance is phenomenon in genes in which a particular genotype masks the expression of alternative genotype and expresses itself due to complete takeover over other.

7 0
3 years ago
2) How many solutions does the equation 4x + 2(x-5) = 3(2x - 4) have? Write down the final form as well as if it has no solution
Brilliant_brown [7]

Answer:

0 = -2, hence no solution.

Explanation:

4x + 2(x-5) = 3(2x-4)

4x + 2x - 10 = 6x - 12

     6x - 6x = -12 + 10

               0 = -2

3 0
2 years ago
The light-harvesting complexes of a chloroplast are located in the ________; the enzymes of the calvin cycle reactions are locat
BartSMP [9]

The light-harvesting complexes of a chloroplast are located in the thylakoid membrane.

The enzymes of the calvin cycle reactions are located in the stroma.

Chloroplast, found in plant cells and some protists such as algae and cyanobacteria, is a cell organelle known as a plastid. Chloroplasts are oval-shaped and have two membranes: an outer membrane and an inner membrane.

The enzymes required during the calvin cyle reaction are present in the stroma while, thylakoid System is the internal membrane system consisting of flattened sac-like membrane structures called thylakoids where light energy is converted into chemical energy. Thylakoids contain the light-harvesting complex, including the electron transport chains used in photosynthesis and pigments like chlorophyll and carotenoids.

To know more about chloroplast visit the link:

brainly.com/question/13783340?referrer=searchResults

#SPJ4

4 0
2 years ago
Can I get a answer please I need help
AnnZ [28]
With what exactly ?
5 0
3 years ago
Which nervous system controls the voluntary function of the limbs and the sense organs?
Tomtit [17]
<span>The nervous system that controls the voluntary functon of the limbs and the sense organs is called the Autonomic nervous system. The Autonomic nervous system is make up of both, the Parasympathetic nervous system and the Sympathetic nervous system.</span>
8 0
4 years ago
Other questions:
  • Does human can develop night vision?​
    6·2 answers
  • A mutation in a DNA molecule is passed to offspring only<br> when the mutation occurs in a -
    15·2 answers
  • ____refers to the exactness of a measurement whereas ____ refers to how close a measurement is to its actual value
    13·2 answers
  • Help asap 20 pts ill mark brainliest
    8·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • The graphs below illustrate change in a lizard population over time. Which process most likely led to the change in the lizard p
    8·2 answers
  • 1.
    7·2 answers
  • Organismo unicelular y procariota​
    15·1 answer
  • Can you write a summary about cells
    9·2 answers
  • Describe one method for temporarily storing carbon in the natural cycle.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!