1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wel
3 years ago
5

Pyrolobus fumarii, an extreme thermophile, can survive at a temperature as high as 113°C. This microorganism could be categorize

d as which of the following?
Biology
1 answer:
KengaRu [80]3 years ago
4 0
 the answer is archaeabacteria

You might be interested in
Which of the answer choices is a cross section of the highlighted region of the mushroom in the picture
Daniel [21]

Answer:

<em>The mushroom in the picture and the option choices are included in the attached image. below...</em>

The highlighted region of the mushroom in the picture represents the mushroom's <em>"Gills"</em>, and paticularlly the multicellular structure carrying the <em>Hymenium</em> called <em>"the basidiocarp"</em> aka basidioma; the Hymenium or underside of the mushrooms is comprised of vertical plates arranged radially, and if a cross section of this is exposed by making a straight cut through the basidiocarp on a microscope, it would appear as option: (A. )

4 0
3 years ago
Who is father of biology​
olya-2409 [2.1K]
Aristotle is the father of biology
8 0
2 years ago
Read 2 more answers
Assess whether urban or rural areas are more likely to have high levels of smog.
yan [13]

The urban areas are more likely to have smog than the rural areas.

Urban area can be referred to as the town or city with advances an developments. Since the urban areas have more population density, more electronic items, vehicles and also industries, that is the reason why they are more likely to produce the smog or any other form of pollution.

Smog is a type of air pollution formed dye to the combination of smoke and fog. The most common source of smog is the burning of coal. This can be either due to industries or the fuels of vehicles. Fog can be of two types: Photochemical smog and industrial smog.

To know more about smog, here

brainly.com/question/15728274

#SPJ4

6 0
2 years ago
Two yeast cells were placed into a special container to which food was continually added, to keep it at a constant concentration
Andrews [41]

Answer:

Answer to Two yeast cells were placed into a special container to which food was continually ... All Other Factors Were Set For Optimal Yeast Growth (for Example, ... The Population Was Sampled Every Hour For 21 Hours And The Results Of The ... to which food was continually added, to keep it at a constant concentration.

Explanation:

Answer to Two yeast cells were placed into a special container to which food was continually ... All Other Factors Were Set For Optimal Yeast Growth (for Example, ... The Population Was Sampled Every Hour For 21 Hours And The Results Of The ... to which food was continually added, to keep it at a constant concentration.

4 0
3 years ago
A student inoculates a gelatin tube and places it at 37C for the week. When he comes back he takes the tube out of the incubator
ycow [4]
<h2>Gelatin </h2>

Explanation:

Gelatin is a differential medium which tests the ability of an organism to produce an exoenzyme, called gelatinase (this enzyme hydrolyzes gelatin)

When gelatin is at a temperature below 32°C (or within a few degrees thereof), it is a semisolid material and at temperatures above 32°C, it is a viscous liquid

When gelatin is broken down, it can no longer solidify and if an organism can break down gelatin, the areas where the organism has grown will remain liquid even if the gelatin is refrigerated

No the conclusion by student is not right because the tube must be runny after incubation followed by refrigeration to be considered gelatinase positive

3 0
3 years ago
Other questions:
  • ///////WILL MARK BRAINLIEST///////////NEED HELP ASAP////////////////////////////
    10·2 answers
  • What is haldane oparin theory?
    10·1 answer
  • DNA is an example of a complex
    10·1 answer
  • Why will all plants not grow equally well in the same conditions?
    9·1 answer
  • Hai pplz plz help me im helping my brother <br><br><br> thxxx :)
    9·2 answers
  • What could happen if a person doesn’t get the proper amount of protein in his or her diet? the impact of a diet lacking in prote
    11·2 answers
  • What is a goblet cell?
    11·1 answer
  • Select all of the answers that apply.
    9·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • 3.Which is an application of genetic engineering?Required to answer. Single choice.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!