During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
It’s opening a box then closing it back then open then close
In the case of the gene that determines high cholesterol in the blood, the two alleles express incomplete dominance.
What this means is that the dominant allele is not completely dominant over the recessive allele. If the allele was completely dominant, even one allele would be enough to determine the individual's trait as dominant. But in the case of incomplete dominance between the alleles, the heterozygous individuals that have one dominant and one recessive allele are an ''in between'' phenotype.
Answer:
i can only define the terms for you.
Explanation:
chromosome - a threadlike structure of nucleic acids and protein found in the nucleus of most living cells, carrying genetic information in the form of genes.
chromatid - each of the two threadlike strands into which a chromosome divides longitudinally during cell division, each containing a double helix of DNA.
gene - a distinct sequence of nucleotides that forms a part of a chromosome, the order of which determines the order of monomers in a polypeptide or nucleic acid molecule which a cell or virus that may synthesize
