1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elza [17]
3 years ago
14

How do i find out the answer to this question?

Biology
1 answer:
navik [9.2K]3 years ago
3 0

The population of bacteria growed rapidly in section B, but stayed the same rate in Section C

:)

You might be interested in
The enzyme acetylcholinesterase causes acetylcholine to
tatiyna

Answer:

A) decompose.

Explanation:

  • Acetylcholine is a neurotransmitter that acts at the neuromuscular junction and activates the muscles.
  • The neurotransmitter acetylcholine is hydrolyzed by the enzyme acetylcholinesterase into choline and acetate.
  • Due to the activity of acetylcholinesterase, the acetylcholine does not remain for long in the synapses and thus, the synaptic transmission is terminated by the enzyme. 
3 0
3 years ago
What is the most common cutaneous receptor found in the skin?
shtirl [24]

The density and variety of receptors vary in different regions. For example, in hairy skin the peritrichial endings are most common, but Merkel's discs and free nerve endings are also present. In glabrous (hairless) skin, free nerve endings are present, as are Merkel's discs and Meissner's corpuscles.

7 0
3 years ago
But this on your own sentences please
alina1380 [7]
Since hydropower is powered by water, it’s a good fuel source. It will not contaminate the air like power plants that release fossil fuels, for example coal and oil. It does not rely on international fuel sources and lets each state make their own energy.
3 0
3 years ago
What protozoan are pathogen <br>​
DaniilM [7]
Pathogenic protozoa comprise a large number of eukaryotic microorganisms which are the causative agent of important parasitic diseases. Some affect human and are of high medical relevance as malaria, toxoplasmosis, leishmaniasis, the Chagas disease, sleepiness disease, amebiasis, giardiasis, and trichomoniasis.
3 0
3 years ago
How many different tastes can you detect with the taste receptor cells on your tongue? seven five three one
Vsevolod [243]
Humans have 5 taste receptor cells.

sweet, salty, bitter, spicy, and umami
8 0
3 years ago
Read 2 more answers
Other questions:
  • PLEASE HELP
    11·2 answers
  • What is the effect of temperature on the rate of photosynthesis
    11·1 answer
  • If you wanted to listen to the activity in the rumen of a cow, where would be the best area to place your stethoscope?
    7·1 answer
  • Sections of our DNA that control what traits we have are called _____________________
    8·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Where did the Twelve Olympians live?
    6·2 answers
  • When you notice that someone has unusually blue eyes, you've noticed their
    14·1 answer
  • IS ATOM ABIOTIC OR BIOTIC
    14·1 answer
  • PLEASE HELP WILL MARK BRAINLIEST
    14·1 answer
  • 100 points! Answer these questions right now!
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!