1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Romashka [77]
3 years ago
13

The Hershey-Chase experiment used a blender and a centrifuge. Contemplate the importance or unimportance of these devices to the

overall results and choose which statement is true.
A) If the blender had been used but no centrifuge, it would have yielded the same basic results, with DNA being the heritable material.

B) The blender was a preliminary test step but was unnecessary. The centrifuge would have created the same separation and yielded the same results—DNA being the heritable material.

C) The centrifuge was used to make the work of studying the results with a microscope easier, but it still could be seen that both the inside and the outside of the bacterial cells were always labeled had only a blender been used. The valid conclusion would be DNA as heritable material.

D) Without the blender, the protein coat would have stayed on the bacteria cell membrane. This would cause the results to be that both the protein and the DNA were parts of the heritable material.
Biology
2 answers:
otez555 [7]3 years ago
4 0
Hi there, i believe the answer to this question is b
vitfil [10]3 years ago
3 0

Answer:

D

Explanation:

I just took the test and the answer was D.

You might be interested in
(b)
zhannawk [14.2K]
The answer is bb (the only possible option because all the others suggest the woman’s eyes are brown)
4 0
3 years ago
If a blind person can't see how do they know what they are touching and do they know if the person they are talking to is a boy
kicyunya [14]

po dotyku i słuchu...

5 0
2 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Which organ systems work together to supply nutrients and oxygen to the brain? A. the skeletal, immune, and excretory systems B.
Maslowich

Answer:

D

Explanation:

5 0
3 years ago
Barnacles create home sites by attaching themselves to whales. This relationship neither harms nor benefits the whales. *
myrzilka [38]
The answer is commensalism.
4 0
3 years ago
Other questions:
  • Can someone help me with 8 & 9? I took a guess but I'm not too sure, ty
    6·1 answer
  • Each parent has two of these for a particular gene
    12·1 answer
  • Label the reproductio system
    7·1 answer
  • What are the SI units of measurement (in science)
    15·2 answers
  • The cell body that contains the nucleus, which includes DNA and other structures that support the neuron, is called the
    15·1 answer
  • How does the pH of milk change when it is fermented to make yoghurt​
    13·1 answer
  • What is the “self”? When we say “myself” or “yourself” what are we referring to?
    8·2 answers
  • You're smart, thanks so much and do you know the missing answers to this: The Endothelial cell lining a ANSWER adjacent to a sit
    10·1 answer
  • What is the potential energy of a pendulum with a mass of 0.7 kg, a height of 0.3 m, and a value of g equal to 9.8 m/s 2 ?
    6·2 answers
  • If a significant decrease in the African wildcat population is observed, what change, if any,
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!