1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bekas [8.4K]
3 years ago
10

A scientist discovers that a soil bacterium he has been studying produces an antimicrobial that kills Gram negative bacteria. Sh

e isolates and purifies the antimicrobial compound, then chemically converts a chemical side chain to a hydroxyl group. When she tests the antimicrobial properties of this new version, she finds that this antimicrobial drug can now also kill Gram-positive bacteria. The new antimicrobial drug with broad-spectrum activity is considered to be:
Biology
1 answer:
nexus9112 [7]3 years ago
4 0

The question is incomplete as it does not have the options which are:

resistant

semisynthetic

synthetic

natural

Answer:

Semisynthetic

Explanation:

Antibiotics are the microbial compounds which are obtained from the micro-organisms which are found effective against the bacteria as they act by inhibiting the activity of the bacteria which ultimately kills the bacteria.

These antibiotics can also be distinguished based on their synthesis: natural, semi-synthetic and synthetic antibiotics.

The semi-synthetic antibiotics are the antibiotics which are obtained from the microbes but are modified artificially by making chemical changes to increase the effectiveness of the antibiotic and making the antibiotic as broad-spectrum bacteria.

Since the properties of the antibiotics provided in the question are similar to the semi-synthetic antibiotics, therefore, is considered semi-synthetic bacteria.

Thus, Semisynthetic  is correct.

You might be interested in
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
The cellular processe diffusion does not requir
JulijaS [17]
It too does Not require cellular energy. When molecules cannot move through a cell membrane passively, the Cell uses a process called_____________. This process uses_______________ found in the cells Membrane to pass particles and reach equilibrium.
3 0
3 years ago
When did Mendel complete his study on peas?<br> O 1900<br> O 1905<br> O1866<br> O 1877
trapecia [35]

Answer:

the answer is 1866

8 0
3 years ago
Imagine two populations of a fish species, one in the Mediterranean Sea and one in the Caribbean Sea. Now imagine two scenarios:
jasenka [17]

Answer:  (1) The populations breed separately.

Explanation:

The genetic diversity can be define as the total number of different types of genes is present in a particular species. Genetic diversity makes the way suitable for the survival of the population of species in changing environment.  

According to the given situation, if the two population breed separately then then no new genes will be added to the gene pool of the species and hence, the genetic diversity will be lost.

4 0
3 years ago
What was the effect of thyroxine injections on the hypophysectomized rat's bmr? how does the bmr in this case compare with the n
denis23 [38]
Thyroxine is a hormone that is  secreted by the thyroid gland to the blood stream. BMR is the basal metabolic rate that is affected by the levels of thyroxine hormone in the system. Hypophysectomy is the removal of the pituitary gland from an organism, in this case the rats. BMR rate of the rat seemed to increase with the injection of thyroxine however the BMR was still lower than the BMR of a normal rat with the thyroid gland  and the dose was too low.
5 0
3 years ago
Other questions:
  • Within each kidney, blood capillaries and structures called glomerular capsules are made of an epithelial tissue specifically su
    14·2 answers
  • If the genotype of both parents was Aa, what would be expected of the genotypes among their possible offspring? Half would have
    14·2 answers
  • What two forces shape an organism’s characteristics?
    10·2 answers
  • Where would the temperature be the highest?
    7·1 answer
  • When measuring for pH, you are measuring for the presence of these ions?
    15·1 answer
  • In humans, brown eyes (B) are dominant, and blue eyes are recessive (b). If a homozygous dominant male is crossed with a heteroz
    9·1 answer
  • Both plants and animals have these organelles to store and pass on genetic information
    10·1 answer
  • If 4,000 units of energy are available in the producer level ,about how much would be available to the tertiary consumers?
    5·1 answer
  • The gene for red-green colorblindness is located on
    10·1 answer
  • Consider the following geometric solids a sphere with a ratio of surface area to volume equal to 0.08 M negative one a right cir
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!