1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ludmilka [50]
4 years ago
11

Why do most biologists believe that true commensalism does not exist? A.an ecosystem usually has more parasites than hosts B.ani

mals of different species usually do not like to work together C.the relationships are probably mutual or parasitic D.animals of the same species rarely compete with one another
Biology
2 answers:
Rudik [331]4 years ago
7 0

Answer: C.the relationships are probably mutual or parasitic

 

Explanation:

Commensalism is a symbiotic association in which one species receives the benefit for association the other remains unaffected. The beneficiary species may receive shelter, nutrients, and support from the host species.

The biologists believe that the commesalism does not exists due to the fact that mostly all organisms live in either parasitic or mutual relationship. As the commesalism can be considered as unrealistic as the host may not allow the commensal or beneficiary species to be associated for long without receiving any benefit.

garik1379 [7]4 years ago
3 0
C sounds correct... ...
You might be interested in
Which statement best describes how some trees respond to decreasing
Alekssandra [29.7K]

Answer:

its a

Explanation:

6 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
Which of these is NOT a principle of the cell theory as it is currently understood? A) Cells are the basic units of life B) All
Flauer [41]

Answer:

D) Only cells containing Mitochondria can reproduce.

3 0
4 years ago
HELP ME OUT PLEASE!!!!!!!!!!!!!!!
Allisa [31]

the moon phase is a Waxing Gibbous

7 0
2 years ago
If your leg was to get cut off where would you feel the pain?
Serga [27]

The thigh area will feel much more pain as when leg is cut off , all nerves are together in thighs, so more pain will be there.

<em>Hope</em><em> it</em><em> helps</em><em> you</em><em>.</em><em>.</em><em>.</em><em> </em><em>pls</em><em> mark</em><em> brainliest</em><em> if</em><em> it</em><em> helped</em><em> you</em>

6 0
3 years ago
Other questions:
  • A student conducts an experiment to determine how the amount of water given to a plant affects its growth.
    9·2 answers
  • Life cycle of a low mass star
    10·1 answer
  • Can somebody help me label this map plz!!!!
    11·1 answer
  • A. What gas do plants give off in the light?
    5·1 answer
  • Which property of water molecules explains the other properties listed below
    14·1 answer
  • Lowest of low tides occur approximately how often?
    6·1 answer
  • Try to compare the landscape differences between the surface of the moon and the surface of the earth​
    10·1 answer
  • Explain how to identify<br> a starting position on a line.
    12·1 answer
  • All living things have internal that helps them carry out basic functions.​
    8·2 answers
  • Does sound travel faster in a warm room or a cold room?<br> Edplain your answer.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!