Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
The correct answer is option - phagocytosis.
Explanation:
The explained experiment is the pulse-chase experiment in this the cells that are involved are macrophages. Macrophages are the immunity cells that have a large number of the lysosomes for killing the pathogens enters in the cell brought into the cell through the process of phagocytosis.
Phagocytosis takes place with the help of the enzyme called hydrolytic enzyme that is synthesized in the endoplasmic reticulum and modified by Golgi and moves to the lysosome.
Thus, the correct answer is option - phagocytosis.
All plant cells because all plants and or trees use photosynthesis for the same thing.
Answer and Explanation:
a. This is a complete flower. Complete flowers are those formed by chalice, corolla, androecium and gynoecium. In the case of the flower presented above, we can see that it has gynoecium because it has a stigma that is part of the gynoecium composition. We can also see that she has androecium, because she has an anther that is part of the composition of androecium. The flower also has a corolla and chalice, since the chalice is formed by the sepals and the corolla by the petals.
b. This is a perfect flower, as we can see that androecium and gynoecium are present in the same flower. Imperfect flowers are those with only androecium or gynoecium.
c. The flower has bilateral symmetry, which is common in all orchids. This type of symmetry allows the flower to only be divided into two equal parts. Radial symmetry, on the other hand, allows flowers to be divided into many equal parts.
