1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natita [175]
3 years ago
11

How are viruses and bacteria different?

Biology
2 answers:
Ivahew [28]3 years ago
8 0

Viruses go around in the air and bacteria you have to touch

Oxana [17]3 years ago
7 0

Answer: Bacteria are living, and viruses are nonliving

Explanation:

You might be interested in
Although armand has been in several fierce battles during the war, he awakens on the morning of a planned invasion completely bl
pishuonlain [190]

<span>If Armand has been in several fierce battles during the war, and suddenly awakens on the morning of a planned invasion with complete blindness for which the doctors find no medical cause. The doctors would suspect that Armand has a CONVERSION DISORDER. More so, that he has an unconcerned disposition towards the sudden blindness.</span>

5 0
4 years ago
Which example best represents the use of creativity in scientific inquiry?
patriot [66]
Scientific inquiry when a student would find ideas and gather thoughts on a topic and think about it in depth. An example would be to gather ideas on how animals live in a certain park more than another. 
6 0
4 years ago
Chloroplasts and bacteria are ___ in size.
natka813 [3]

They are similar in size.

5 0
4 years ago
Witch contribution did Kepler make to viewing the solar system? A: He proposed the earth-centered model of the solar system. B:
Ira Lisetskai [31]

Answer:

<u>C: He showed that planets moved in elliptical orbits.</u>

Explanation:

Copernicus described the solar system model with Sun at its center and planets along with their moons revolving about the Sun in circular orbits. This model is known as heliocentric model and this shift from geocentric model is known as Copernican revolution. Kepler supported the heliocentric model but showed that the planets revolved in elliptical orbits with the Sun at one of its foci. He wrote laws describing the planetary motion.

3 0
4 years ago
Is this statement True or False?
Alexxandr [17]

Answer: True

Explanation: Aa x Aa

8 0
1 year ago
Other questions:
  • Immunoglobulins that attach to and sensitize mast cells and basophils are
    8·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Now look at the green lines you created by connecting the three boiling point data points
    9·2 answers
  • 10. Hemoglobin is an example of
    8·2 answers
  • What is true of the parents of an organism with the genotype, aa?
    11·1 answer
  • Where is the moon when you are in a location experiencing a low tide?
    10·1 answer
  • Seafloor spreading is a process that occurs on a ________________________ boundary.
    8·1 answer
  • ___ are the reproductive structures of gymnosperms.
    7·1 answer
  • What is meiosis?? I have no clue what is means... Plz plz plzzz answer withOUT links!!! I’ll give whoever answers the best, the
    12·1 answer
  • Heyyyyooooo vujhnerugheriughr
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!