1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mnenie [13.5K]
3 years ago
10

Oxytocin is responsible for causing contractions of uterine smooth muscle during labor. preventing the formation of goiters. pre

venting release of insulin from the pancreas. milk production by the mammary glands. regulating blood calcium levels.
Biology
1 answer:
zepelin [54]3 years ago
6 0

Answer:

the correct option is:

a. causing contractions of the uterine smooth muscle during childbirth.

Explanation:

The question is: what is oxytocin responsible for?

a. causing contractions of the uterine smooth muscle during childbirth.

Oxytocin is responsible, being this the correct answer.

b. prevents the formation of goiters.

Thyroid hormone regulates this process.

C. Prevent the release of insulin from the pancreas.

Hormones epinephrine and norepinephrine.

d. milk production by the mammary glands.

It is prolactin who is responsible for this process

e. regulating blood calcium levels.

They are the parathormone and calcitonin.

You might be interested in
How does the changing nature of water rights relate to the investigation phenomenon
____ [38]

Answer:

Natural disasters are caused due to different reasons like soil erosion, seismic activity, tectonic movements, air pressure, and ocean currents etc. Natural activities taking place in the earth's crust, as well as surface, are the main reasons for these disasters.

3 0
2 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
The dew point is reached when___.
ElenaW [278]
C. When the air cannot support any more water vapor
3 0
2 years ago
What short-term outcome would underage drinkers most likely to experience
adell [148]

Under development of the brain.

8 0
3 years ago
Read 2 more answers
What is the Mechanical energy when
Scilla [17]

Answer:

ME = 20 * m, where m is the mass of the pendulum

Explanation:

As we know that mechanical energy is the sum of kinetic energy and potential energy.

Since the Pendulum at its highest point has zero velocity, its kinetic energy at this point is equal to zero.

Thus, here in this mechanical energy will be equal to the potential energy only.

Potential energy is equal to the product of gravity constant, mass of the body and the height of the pendulum

Thus,

ME = PE\\

PE = m * g* h\\PE = 10 * 2* m\\

PE= 20m

Hence,

ME = 20 * m

5 0
3 years ago
Other questions:
  • HELP ME PLEASE. 35 POINTS
    9·2 answers
  • What can you do if the bicyclist moves into your path of travel?
    9·1 answer
  • Which is the primary process by which evolution of life on Earth occurs?
    12·1 answer
  • Which of the following is true about the DNA molecule during transcription?
    6·1 answer
  • Submerging a red blood cell in distilled water will result in
    14·2 answers
  • What is a income variable in science terms plz answer I need it by midnight today
    12·1 answer
  • Which is the correct answer?.
    13·2 answers
  • Someone help please.
    5·1 answer
  • 20. A solution of pH 2.8 is?<br> A. acidic<br> B. basic<br> N. neutral
    13·1 answer
  • How can I describe the yearly temperatures of the Tundra biome?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!